Rh6DG186100

INO80 complex subunit D-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001489
Physical Location & Seq
Reverse (-)
33103224 .. 33103502
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG186100.1

Sequence Viewer

Length: 279 bp
ATGTGTGTTTGTAGTGCTCAGGCAAGACCTATAACATGTGGGAAGCCAATACTGAGATCCACTACCCCTTCTCTTTGTACTGTCCACTTCCAAAAGGCTCAGAAGCATGTAACCAGGGCCTTGCGGAAGGCGGGGCTTAACGTTTCCTCATCAAGTAAACTTGCTCCCAAGTTCCATGTGATCGTGGCAGAATACATACGCCAAATCCAATCCACACGAAGAGCCGCACGAAAGGAAAATAAAAGTAAAGTTGCAATAAAGGAAGAAACAGCTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-C3Hc3H

Protein Analysis

92

Amino Acids

10.18

Weight (kDa)

10.42

Isoelectric Point (pI)

47.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 124, 131, 225
AclI AACGTT 1 cut(s) 141
AclWI GGATC 1 cut(s) 51
AfaI GTAC 1 cut(s) 79
AflIII ACRYGT 1 cut(s) 35
AjnI CCWGG 1 cut(s) 113
AluBI AGCT 1 cut(s) 272
AluI AGCT 1 cut(s) 272
Alw21I GWGCWC 1 cut(s) 19
AlwI GGATC 1 cut(s) 51
AoxI GGCC 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 117
Bbv12I GWGCWC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 115
BisI GCNGC 1 cut(s) 225
BlsI GCNGC 1 cut(s) 226
Bme1390I CCNGG 1 cut(s) 115
BmgT120I GGNCC 1 cut(s) 117
BmrFI CCNGG 1 cut(s) 115
Bpu10I CCTNAGC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 114
BseMII CTCAG 3 cut(s) 32, 44, 113
BshFI GGCC 1 cut(s) 119
BsiHKAI GWGCWC 1 cut(s) 19
BsnI GGCC 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 19
Bsp143I GATC 2 cut(s) 56, 180
BspACI CCGC 3 cut(s) 124, 131, 225
BspANI GGCC 1 cut(s) 119
BspCNI CTCAG 3 cut(s) 31, 45, 112
BspPI GGATC 1 cut(s) 51
BspQI GCTCTTC 1 cut(s) 214
BssECI CCNNGG 1 cut(s) 114
BssMI GATC 2 cut(s) 56, 180
Bst2UI CCWGG 1 cut(s) 115
Bst4CI ACNGT 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 214
BstDEI CTNAG 3 cut(s) 18, 53, 99
BstKTI GATC 2 cut(s) 59, 183
BstMBI GATC 2 cut(s) 56, 180
BstNI CCWGG 1 cut(s) 115
BstNSI RCATGY 2 cut(s) 39, 110
BstSCI CCNGG 1 cut(s) 113
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BsuRI GGCC 1 cut(s) 119
Cfr13I GGNCC 1 cut(s) 117
Csp6I GTAC 1 cut(s) 78
CviAII CATG 3 cut(s) 36, 107, 176
CviJI RGCY 6 cut(s) 46, 98, 119, 136, 224, 272
CviKI_1 RGCY 6 cut(s) 46, 98, 119, 136, 224, 272
CviQI GTAC 1 cut(s) 78
DdeI CTNAG 3 cut(s) 18, 53, 99
DpnI GATC 2 cut(s) 58, 182
DpnII GATC 2 cut(s) 56, 180
Eam1104I CTCTTC 1 cut(s) 214
EarI CTCTTC 1 cut(s) 214
EcoO109I RGGNCCY 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 113
FaeI CATG 3 cut(s) 39, 110, 179
FaiI YATR 5 cut(s) 32, 37, 108, 177, 197
FatI CATG 3 cut(s) 35, 106, 175
FauI CCCGC 1 cut(s) 124
Fnu4HI GCNGC 1 cut(s) 225
Fsp4HI GCNGC 1 cut(s) 225
GluI GCNGC 1 cut(s) 225
HaeIII GGCC 1 cut(s) 119
Hin1II CATG 3 cut(s) 39, 110, 179
Hpy166II GTNNAC 2 cut(s) 85, 158
Hpy188I TCNGA 1 cut(s) 102
Hpy8I GTNNAC 2 cut(s) 85, 158
HpyAV CCTTC 2 cut(s) 78, 121
HpyCH4III ACNGT 1 cut(s) 82
HpyCH4IV ACGT 1 cut(s) 141
HpyCH4V TGCA 1 cut(s) 254
HpyF3I CTNAG 3 cut(s) 18, 53, 99
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 3 cut(s) 39, 110, 179
Kzo9I GATC 2 cut(s) 56, 180
LguI GCTCTTC 1 cut(s) 214
LmnI GCTCC 1 cut(s) 169
LpnPI CCDG 3 cut(s) 5, 100, 127
MaeII ACGT 1 cut(s) 141
MaeIII GTNAC 1 cut(s) 109
MalI GATC 2 cut(s) 58, 182
MboI GATC 2 cut(s) 56, 180
MboII GAAGA 2 cut(s) 231, 275
MflI RGATCY 1 cut(s) 56
MhlI GDGCHC 1 cut(s) 19
MnlI CCTC 1 cut(s) 157
MseI TTAA 1 cut(s) 138
MspA1I CMGCKG 1 cut(s) 272
MspR9I CCNGG 1 cut(s) 115
MvaI CCWGG 1 cut(s) 115
NdeII GATC 2 cut(s) 56, 180
NlaIII CATG 3 cut(s) 39, 110, 179
NspI RCATGY 2 cut(s) 39, 110
PciI ACATGT 1 cut(s) 35
PciSI GCTCTTC 1 cut(s) 214
PkrI GCNGC 1 cut(s) 226
PscI ACATGT 1 cut(s) 35
Psp1406I AACGTT 1 cut(s) 141
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspPI GGNCC 1 cut(s) 117
PsuI RGATCY 1 cut(s) 56
PvuII CAGCTG 1 cut(s) 272
RsaI GTAC 1 cut(s) 79
RsaNI GTAC 1 cut(s) 78
SapI GCTCTTC 1 cut(s) 214
SaqAI TTAA 1 cut(s) 138
SatI GCNGC 1 cut(s) 225
Sau3AI GATC 2 cut(s) 56, 180
Sau96I GGNCC 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 115
SduI GDGCHC 1 cut(s) 19
SetI ASST 3 cut(s) 31, 144, 274
SsiI CCGC 3 cut(s) 124, 131, 225
StyD4I CCNGG 1 cut(s) 113
TaaI ACNGT 1 cut(s) 82
TaiI ACGT 1 cut(s) 144
TatI WGTACW 1 cut(s) 77
TauI GCSGC 1 cut(s) 227
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
XceI RCATGY 2 cut(s) 39, 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.