Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr09

Orthogroup ID

OG0005203

Physical Location & Seq

Genomic Coordinates Reverse (-)

1131176 .. 1138678

Gene Structure 7503 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD09G1018300.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGAATGGGGGGGCTTTGGCCGAAGAACCTCCGATGCCAAAGTTAGAATTTAGAGAGAAAGAGTGTTTAGAGAATTTTCTTTTTGGTGAGAATGGGAGTATATTTATAGGGATAGGAGGTGGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

42

Amino Acids

4.4

Weight (kDa)

4.36

Isoelectric Point (pI)

41.38

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005203)

Species	Orthologous Gene IDs
malus_domestica	MD09G1018300.v1.1 MD15G1351900.v1.1
pyrus_communis	pycom01g01670 pycom01g02670 pycom01g06610 pycom02g17260 pycom03g10760 pycom04g07500 pycom04g07720 pycom04g09270 pycom05g08140 pycom05g09680 pycom06g08870 pycom06g09050 pycom07g06460 pycom07g12370 pycom10g06120 pycom11g13350 pycom13g13860 pycom13g17300 pycom13g17590 pycom13g23100 pycom13g23430 pycom13g23810 pycom14g06700 pycom15g26510 pycom15g27360 pycom15g35060 pycom15g35080 pycom16g15840

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	18
AcsI	RAATTY	2 cut(s)	47, 73
AoxI	GGCC	1 cut(s)	18
ApoI	RAATTY	2 cut(s)	47, 73
AsuHPI	GGTGA	1 cut(s)	98
BfaI	CTAG	1 cut(s)	124
BmsI	GCATC	1 cut(s)	24
BshFI	GGCC	1 cut(s)	20
BsnI	GGCC	1 cut(s)	20
BspANI	GGCC	1 cut(s)	20
BsuRI	GGCC	1 cut(s)	20
CviJI	RGCY	3 cut(s)	14, 20, 123
CviKI_1	RGCY	3 cut(s)	14, 20, 123
EaeI	YGGCCR	1 cut(s)	18
FaiI	YATR	2 cut(s)	101, 107
FspBI	CTAG	1 cut(s)	124
HaeIII	GGCC	1 cut(s)	20
HphI	GGTGA	1 cut(s)	98
Hpy188I	TCNGA	1 cut(s)	33
LweI	GCATC	1 cut(s)	24
MaeI	CTAG	1 cut(s)	124
MboII	GAAGA	1 cut(s)	35
MluCI	AATT	2 cut(s)	47, 73
MnlI	CCTC	2 cut(s)	39, 110
SetI	ASST	2 cut(s)	31, 121
SfaNI	GCATC	1 cut(s)	24
Sse9I	AATT	2 cut(s)	47, 73
SspMI	CTAG	1 cut(s)	124
TasI	AATT	2 cut(s)	47, 73
TspDTI	ATGAA	1 cut(s)	17
XapI	RAATTY	2 cut(s)	47, 73
XspI	CTAG	1 cut(s)	124

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.