pycom05g09680

Replication protein A interacting middle

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Forward (+)
12911269 .. 12911849
581 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g09680.3

Sequence Viewer

Length: 354 bp
ATGCTGGTTAAGAAAGAATTGAAGACTTCCTTCGCTGCTCGTGAGGGTCCACCTACTGTCAAGAGGCTTGTGATTGACATGACTTCTTCCAATGGGAAGAAAAATGAGGCTGCTAGATTTGAGCATATGAGCGATAAGGTGGACTCTGCTGCTAAAGTGGCGCTAAGGCCCACTCCCTCTATTGCTGAGACTAATTCGCTTACTGGGAAGGAGGAGGCTGCTCGTGTGGGTGGCTGTGAGAAATCCACTAAGCCTGCTTCTAGGGAGGCTGCTGAGATATGTGATAAAGAGTTGATTGCTGCTTATAATCAAGTGATCCATTTCAAGAGAATCGTCGATAGGCTTGAACCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

118

Amino Acids

12.81

Weight (kDa)

9.17

Isoelectric Point (pI)

23.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 306
AclWI GGATC 1 cut(s) 310
AgsI TTSAA 3 cut(s) 22, 325, 347
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 1 cut(s) 310
AoxI GGCC 1 cut(s) 167
ApeKI GCWGC 6 cut(s) 35, 110, 149, 218, 269, 299
AspLEI GCGC 1 cut(s) 163
AspS9I GGNCC 2 cut(s) 47, 168
AvaII GGWCC 1 cut(s) 47
BauI CACGAG 2 cut(s) 39, 222
BbsI GAAGAC 1 cut(s) 29
BbvI GCAGC 6 cut(s) 22, 97, 136, 205, 256, 286
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 2 cut(s) 114, 261
BfoI RGCGCY 1 cut(s) 164
BisI GCNGC 6 cut(s) 36, 111, 150, 219, 270, 300
BlsI GCNGC 6 cut(s) 37, 112, 151, 220, 271, 301
Bme18I GGWCC 1 cut(s) 47
BmgT120I GGNCC 2 cut(s) 47, 168
BmiI GGNNCC 1 cut(s) 48
BmrI ACTGGG 1 cut(s) 213
BmuI ACTGGG 1 cut(s) 213
BpiI GAAGAC 1 cut(s) 29
Bpu10I CCTNAGC 1 cut(s) 164
Bse1I ACTGG 1 cut(s) 208
BseMII CTCAG 2 cut(s) 177, 264
BseNI ACTGG 1 cut(s) 208
BseRI GAGGAG 1 cut(s) 227
BseXI GCAGC 6 cut(s) 22, 97, 136, 205, 256, 286
BshFI GGCC 1 cut(s) 169
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 315
BspANI GGCC 1 cut(s) 169
BspCNI CTCAG 2 cut(s) 178, 265
BspLI GGNNCC 1 cut(s) 48
BspPI GGATC 1 cut(s) 310
BsrI ACTGG 1 cut(s) 208
BssMI GATC 1 cut(s) 315
BssSI CACGAG 2 cut(s) 39, 222
Bst2BI CACGAG 2 cut(s) 39, 222
Bst4CI ACNGT 1 cut(s) 58
BstC8I GCNNGC 1 cut(s) 255
BstDEI CTNAG 4 cut(s) 164, 186, 249, 273
BstH2I RGCGCY 1 cut(s) 164
BstHHI GCGC 1 cut(s) 163
BstKTI GATC 1 cut(s) 318
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 315
BstMWI GCNNNNNNNGC 1 cut(s) 158
BstV1I GCAGC 6 cut(s) 22, 97, 136, 205, 256, 286
BstV2I GAAGAC 1 cut(s) 29
BsuRI GGCC 1 cut(s) 169
Cac8I GCNNGC 1 cut(s) 255
CfoI GCGC 1 cut(s) 163
Cfr13I GGNCC 2 cut(s) 47, 168
CviAII CATG 1 cut(s) 79
CviJI RGCY 8 cut(s) 67, 110, 169, 218, 234, 253, 269, 343
CviKI_1 RGCY 8 cut(s) 67, 110, 169, 218, 234, 253, 269, 343
DdeI CTNAG 4 cut(s) 164, 186, 249, 273
DpnI GATC 1 cut(s) 317
DpnII GATC 1 cut(s) 315
Eco47I GGWCC 1 cut(s) 47
FaeI CATG 1 cut(s) 82
FaiI YATR 5 cut(s) 80, 126, 128, 280, 306
FalI AAGNNNNNCTT 2 cut(s) 14, 46
FatI CATG 1 cut(s) 78
FauNDI CATATG 1 cut(s) 126
Fnu4HI GCNGC 6 cut(s) 36, 111, 150, 219, 270, 300
Fsp4HI GCNGC 6 cut(s) 36, 111, 150, 219, 270, 300
FspBI CTAG 2 cut(s) 114, 261
GlaI GCGC 1 cut(s) 162
GluI GCNGC 6 cut(s) 36, 111, 150, 219, 270, 300
HaeII RGCGCY 1 cut(s) 164
HaeIII GGCC 1 cut(s) 169
HhaI GCGC 1 cut(s) 163
Hin1II CATG 1 cut(s) 82
Hin6I GCGC 1 cut(s) 161
HinP1I GCGC 1 cut(s) 161
HinfI GANTC 2 cut(s) 143, 330
Hpy166II GTNNAC 2 cut(s) 50, 142
Hpy188III TCNNGA 3 cut(s) 41, 61, 325
Hpy8I GTNNAC 2 cut(s) 50, 142
Hpy99I CGWCG 1 cut(s) 338
HpyAV CCTTC 2 cut(s) 40, 202
HpyCH4III ACNGT 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 4 cut(s) 164, 186, 249, 273
Hsp92II CATG 1 cut(s) 82
HspAI GCGC 1 cut(s) 161
Kzo9I GATC 1 cut(s) 315
LpnPI CCDG 2 cut(s) 189, 267
Lsp1109I GCAGC 6 cut(s) 22, 97, 136, 205, 256, 286
MaeI CTAG 2 cut(s) 114, 261
MalI GATC 1 cut(s) 317
MboI GATC 1 cut(s) 315
MboII GAAGA 3 cut(s) 34, 78, 109
MluCI AATT 2 cut(s) 17, 193
MlyI GAGTC 1 cut(s) 137
MnlI CCTC 7 cut(s) 37, 57, 100, 187, 205, 208, 259
MseI TTAA 1 cut(s) 9
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeI CATATG 1 cut(s) 126
NdeII GATC 1 cut(s) 315
NlaIII CATG 1 cut(s) 82
NlaIV GGNNCC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 330
PkrI GCNGC 6 cut(s) 37, 112, 151, 220, 271, 301
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
PsiI TTATAA 1 cut(s) 306
PspN4I GGNNCC 1 cut(s) 48
PspPI GGNCC 2 cut(s) 47, 168
SaqAI TTAA 1 cut(s) 9
SatI GCNGC 6 cut(s) 36, 111, 150, 219, 270, 300
Sau3AI GATC 1 cut(s) 315
Sau96I GGNCC 2 cut(s) 47, 168
SchI GAGTC 1 cut(s) 137
SetI ASST 2 cut(s) 55, 141
SinI GGWCC 1 cut(s) 47
Sse9I AATT 2 cut(s) 17, 193
SspMI CTAG 2 cut(s) 114, 261
TaaI ACNGT 1 cut(s) 58
TaqI TCGA 1 cut(s) 336
TasI AATT 2 cut(s) 17, 193
TfiI GAWTC 1 cut(s) 330
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TseI GCWGC 6 cut(s) 35, 110, 149, 218, 269, 299
VpaK11BI GGWCC 1 cut(s) 47
XspI CTAG 2 cut(s) 114, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.