MD10G1001200.v1.1

Phd finger protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
245732 .. 245995
264 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1001200.v1.1.491

Sequence Viewer

Length: 264 bp
ATGAAAGTTAGTGTGATGGATGTGTCTAAGAAGTACAGGATGGAGTACCGGATGTTGGACGCTGTCACCAGCGGTCGTTCTTGGTATGGCAATTGGGGTTATGAATTTGGTGCTGGGAGCTATGCTCTCACTCAACATTCCTACCAAAAGGCAGTGGATACTCTATCTAGCTTGCCTCTATACCCTTTTCTATTCCAACCAAGGAAACCCTGGACTCGCCTCCAGTCTGTTATTGCCTTTTACCATTCGTTATCGGATATCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.15

Weight (kDa)

9.48

Isoelectric Point (pI)

20.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 72
AcsI RAATTY 1 cut(s) 104
AfaI GTAC 2 cut(s) 35, 47
AfiI CCNNNNNNNGG 1 cut(s) 55
AjnI CCWGG 1 cut(s) 209
AluBI AGCT 2 cut(s) 120, 171
AluI AGCT 2 cut(s) 120, 171
ApoI RAATTY 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 58
BccI CCATC 2 cut(s) 10, 34
BciT130I CCWGG 1 cut(s) 211
BciVI GTATCC 1 cut(s) 151
BfaI CTAG 1 cut(s) 168
BfuI GTATCC 1 cut(s) 151
Bme1390I CCNGG 1 cut(s) 211
BmrFI CCNGG 1 cut(s) 211
BplI GAGNNNNNCTC 2 cut(s) 109, 141
BpmI CTGGAG 1 cut(s) 206
BsaJI CCNNGG 2 cut(s) 200, 209
BsaWI WCCGGW 1 cut(s) 48
Bsc4I CCNNNNNNNGG 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 223
BseBI CCWGG 1 cut(s) 211
BseDI CCNNGG 2 cut(s) 200, 209
BseGI GGATG 3 cut(s) 25, 45, 57
BseLI CCNNNNNNNGG 1 cut(s) 55
BseNI ACTGG 1 cut(s) 223
BseYI CCCAGC 1 cut(s) 113
Bsh1285I CGRYCG 1 cut(s) 76
BsiEI CGRYCG 1 cut(s) 76
BsiSI CCGG 1 cut(s) 49
BslI CCNNNNNNNGG 1 cut(s) 55
BspACI CCGC 1 cut(s) 72
BsrI ACTGG 1 cut(s) 223
BssECI CCNNGG 2 cut(s) 200, 209
BssT1I CCWWGG 1 cut(s) 200
Bst2UI CCWGG 1 cut(s) 211
BstC8I GCNNGC 1 cut(s) 173
BstDEI CTNAG 1 cut(s) 27
BstF5I GGATG 3 cut(s) 25, 45, 57
BstMCI CGRYCG 1 cut(s) 76
BstNI CCWGG 1 cut(s) 211
BstSCI CCNGG 1 cut(s) 209
BsuI GTATCC 1 cut(s) 151
BtsCI GGATG 3 cut(s) 25, 45, 57
BtsI GCAGTG 1 cut(s) 159
BtsIMutI CAGTG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 173
CseI GACGC 1 cut(s) 68
Csp6I GTAC 2 cut(s) 34, 46
CviJI RGCY 2 cut(s) 120, 171
CviKI_1 RGCY 2 cut(s) 120, 171
CviQI GTAC 2 cut(s) 34, 46
DdeI CTNAG 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 200
Eco32I GATATC 1 cut(s) 259
EcoRII CCWGG 1 cut(s) 209
EcoRV GATATC 1 cut(s) 259
EcoT14I CCWWGG 1 cut(s) 200
ErhI CCWWGG 1 cut(s) 200
FaiI YATR 4 cut(s) 87, 102, 123, 181
FokI GGATG 3 cut(s) 32, 52, 64
FspBI CTAG 1 cut(s) 168
GsaI CCCAGC 1 cut(s) 117
GsuI CTGGAG 1 cut(s) 206
HapII CCGG 1 cut(s) 49
HgaI GACGC 1 cut(s) 68
HinfI GANTC 1 cut(s) 214
HpaII CCGG 1 cut(s) 49
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 256
HpyF3I CTNAG 1 cut(s) 27
LmnI GCTCC 1 cut(s) 117
LpnPI CCDG 7 cut(s) 22, 62, 82, 99, 196, 223, 236
MaeI CTAG 1 cut(s) 168
MaeIII GTNAC 1 cut(s) 64
MfeI CAATTG 1 cut(s) 91
MluCI AATT 2 cut(s) 91, 104
MlyI GAGTC 1 cut(s) 208
MmeI TCCRAC 2 cut(s) 36, 220
MnlI CCTC 2 cut(s) 186, 230
MspA1I CMGCKG 1 cut(s) 72
MspI CCGG 1 cut(s) 49
MspR9I CCNGG 1 cut(s) 211
MunI CAATTG 1 cut(s) 91
MvaI CCWGG 1 cut(s) 211
NmuCI GTSAC 1 cut(s) 64
PflFI GACNNNGTC 1 cut(s) 62
PleI GAGTC 1 cut(s) 208
PpsI GAGTC 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 209
PspFI CCCAGC 1 cut(s) 113
PspGI CCWGG 1 cut(s) 209
PsyI GACNNNGTC 1 cut(s) 62
RsaI GTAC 2 cut(s) 35, 47
RsaNI GTAC 2 cut(s) 34, 46
SchI GAGTC 1 cut(s) 208
ScrFI CCNGG 1 cut(s) 211
SetI ASST 2 cut(s) 122, 173
Sse9I AATT 2 cut(s) 91, 104
SsiI CCGC 1 cut(s) 72
SspMI CTAG 1 cut(s) 168
StyD4I CCNGG 1 cut(s) 209
StyI CCWWGG 1 cut(s) 200
TasI AATT 2 cut(s) 91, 104
TatI WGTACW 1 cut(s) 33
TscAI CASTG 1 cut(s) 159
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 17, 117
TspRI CASTG 1 cut(s) 159
Tth111I GACNNNGTC 1 cut(s) 62
XapI RAATTY 1 cut(s) 104
XcmI CCANNNNNNNNNTGG 1 cut(s) 207
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.