Rmu_co8274023.1_g000001

PHD-finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8274023.1
OG0004114
Physical Location & Seq
Reverse (-)
100 .. 666
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8274023.1_g000001.1.cds

Sequence Viewer

Length: 567 bp
atgatctgcagggatgttacattggaggatctttccaagaaagggaatgttgatcttcgtttgctctgtggggtggcttacgaaagatcctggttcggtaggtggggctacaaattttggagagggagttatggagtagatgaagtgaagtatgagattgccctagcttgtctccgtaacgttgacatttctcaggttgttgaagtgtttcgcaaggtggaagaccaatatgctctagttcatcgtctagagggagtacttgaacgttaccgacgtctcagtcattccccattcaagactttaagtgacttgcttgtgttcattctgacttatcctgccaaatcaaggatggcaaaagaggcatgtaccattgctagcataccccgcaaaggttggactagggagcaaataaacgagacgttaaaggtactgatcaatatactggataagagaggccctgtaagcggggaagacctcattgaggcatctagctccaaagtaagtccaggtgagctacaggaatgcaccaaattgtggcttgtaaggagaatccaatctcaaatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PHD

Protein Analysis

188

Amino Acids

21.7

Weight (kDa)

9.1

Isoelectric Point (pI)

57.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 279
AatII GACGTC 1 cut(s) 277
AccB7I CCANNNNNTGG 1 cut(s) 534
AciI CCGC 2 cut(s) 385, 465
AclI AACGTT 2 cut(s) 180, 265
AclWI GGATC 2 cut(s) 36, 81
AcsI RAATTY 1 cut(s) 113
AcyI GRCGYC 1 cut(s) 274
AfaI GTAC 3 cut(s) 258, 367, 429
AfiI CCNNNNNNNGG 6 cut(s) 42, 345, 389, 464, 481, 534
AgsI TTSAA 3 cut(s) 203, 263, 295
AjnI CCWGG 2 cut(s) 89, 505
AluBI AGCT 3 cut(s) 167, 492, 514
AluI AGCT 3 cut(s) 167, 492, 514
Alw26I GTCTC 3 cut(s) 176, 281, 410
AlwI GGATC 2 cut(s) 36, 81
AoxI GGCC 1 cut(s) 454
ApoI RAATTY 1 cut(s) 113
Asp700I GAANNNNTTC 1 cut(s) 207
AspS9I GGNCC 1 cut(s) 455
AsuHPI GGTGA 1 cut(s) 521
AsuNHI GCTAGC 1 cut(s) 374
BbsI GAAGAC 2 cut(s) 228, 477
BccI CCATC 1 cut(s) 343
BciT130I CCWGG 2 cut(s) 91, 507
BclI TGATCA 1 cut(s) 432
BcoDI GTCTC 3 cut(s) 176, 281, 410
BfaI CTAG 6 cut(s) 164, 236, 248, 375, 399, 489
BfmI CTRYAG 2 cut(s) 7, 515
BmcAI AGTACT 1 cut(s) 258
Bme1390I CCNGG 2 cut(s) 91, 507
BmgT120I GGNCC 1 cut(s) 455
BmrFI CCNGG 2 cut(s) 91, 507
BmsI GCATC 1 cut(s) 494
BmtI GCTAGC 1 cut(s) 378
BpiI GAAGAC 2 cut(s) 228, 477
BsaHI GRCGYC 1 cut(s) 274
BsaXI ACNNNNNCTCC 2 cut(s) 112, 142
Bsc4I CCNNNNNNNGG 6 cut(s) 42, 345, 389, 464, 481, 534
Bse1I ACTGG 1 cut(s) 447
Bse3DI GCAATG 1 cut(s) 369
BseBI CCWGG 2 cut(s) 91, 507
BseGI GGATG 2 cut(s) 19, 354
BseLI CCNNNNNNNGG 6 cut(s) 42, 345, 389, 464, 481, 534
BseMI GCAATG 1 cut(s) 369
BseMII CTCAG 2 cut(s) 206, 292
BseNI ACTGG 1 cut(s) 447
BshFI GGCC 1 cut(s) 456
BslI CCNNNNNNNGG 6 cut(s) 42, 345, 389, 464, 481, 534
BsmAI GTCTC 3 cut(s) 176, 281, 410
BsmBI CGTCTC 2 cut(s) 281, 410
BsmI GAATGC 1 cut(s) 527
BsnI GGCC 1 cut(s) 456
Bsp143I GATC 5 cut(s) 3, 28, 52, 86, 432
BspACI CCGC 2 cut(s) 385, 465
BspANI GGCC 1 cut(s) 456
BspCNI CTCAG 2 cut(s) 205, 291
BspMAI CTGCAG 1 cut(s) 11
BspOI GCTAGC 1 cut(s) 378
BspPI GGATC 2 cut(s) 36, 81
BsrDI GCAATG 1 cut(s) 369
BsrI ACTGG 1 cut(s) 447
BssMI GATC 5 cut(s) 3, 28, 52, 86, 432
BssNI GRCGYC 1 cut(s) 274
Bst2UI CCWGG 2 cut(s) 91, 507
BstACI GRCGYC 1 cut(s) 274
BstC8I GCNNGC 1 cut(s) 376
BstDEI CTNAG 2 cut(s) 192, 278
BstENI CCTNNNNNAGG 1 cut(s) 479
BstF5I GGATG 2 cut(s) 19, 354
BstKTI GATC 5 cut(s) 6, 31, 55, 89, 435
BstMAI GTCTC 3 cut(s) 176, 281, 410
BstMBI GATC 5 cut(s) 3, 28, 52, 86, 432
BstMWI GCNNNNNNNGC 3 cut(s) 359, 384, 462
BstNI CCWGG 2 cut(s) 91, 507
BstNSI RCATGY 1 cut(s) 366
BstSCI CCNGG 2 cut(s) 89, 505
BstSFI CTRYAG 2 cut(s) 7, 515
BstV2I GAAGAC 2 cut(s) 228, 477
BstX2I RGATCY 2 cut(s) 28, 86
BstYI RGATCY 2 cut(s) 28, 86
BsuRI GGCC 1 cut(s) 456
BtsCI GGATG 2 cut(s) 19, 354
Cac8I GCNNGC 1 cut(s) 376
Cfr13I GGNCC 1 cut(s) 455
Csp6I GTAC 3 cut(s) 257, 366, 428
CviAII CATG 1 cut(s) 363
CviJI RGCY 7 cut(s) 77, 108, 167, 456, 492, 514, 538
CviKI_1 RGCY 7 cut(s) 77, 108, 167, 456, 492, 514, 538
CviQI GTAC 3 cut(s) 257, 366, 428
DdeI CTNAG 2 cut(s) 192, 278
DpnI GATC 5 cut(s) 5, 30, 54, 88, 434
DpnII GATC 5 cut(s) 3, 28, 52, 86, 432
DrdI GACNNNNNNGTC 1 cut(s) 279
DseDI GACNNNNNNGTC 1 cut(s) 279
EcoNI CCTNNNNNAGG 1 cut(s) 479
EcoO109I RGGNCCY 1 cut(s) 455
EcoRII CCWGG 2 cut(s) 89, 505
Esp3I CGTCTC 2 cut(s) 281, 410
FaeI CATG 1 cut(s) 366
FaiI YATR 6 cut(s) 132, 153, 231, 364, 380, 440
FatI CATG 1 cut(s) 362
FauI CCCGC 2 cut(s) 392, 458
FbaI TGATCA 1 cut(s) 432
FokI GGATG 2 cut(s) 26, 361
FspBI CTAG 6 cut(s) 164, 236, 248, 375, 399, 489
HaeIII GGCC 1 cut(s) 456
Hin1I GRCGYC 1 cut(s) 274
Hin1II CATG 1 cut(s) 366
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HinfI GANTC 1 cut(s) 549
HphI GGTGA 1 cut(s) 521
Hpy166II GTNNAC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 327, 566
Hpy188III TCNNGA 2 cut(s) 248, 295
Hpy8I GTNNAC 1 cut(s) 184
Hpy99I CGWCG 1 cut(s) 276
HpyCH4IV ACGT 4 cut(s) 180, 265, 274, 419
HpyCH4V TGCA 2 cut(s) 9, 525
HpyF10VI GCNNNNNNNGC 3 cut(s) 359, 384, 462
HpyF3I CTNAG 2 cut(s) 192, 278
HpySE526I ACGT 4 cut(s) 180, 265, 274, 419
Hsp92I GRCGYC 1 cut(s) 274
Hsp92II CATG 1 cut(s) 366
Ksp22I TGATCA 1 cut(s) 432
Kzo9I GATC 5 cut(s) 3, 28, 52, 86, 432
LmnI GCTCC 2 cut(s) 403, 497
LpnPI CCDG 9 cut(s) 76, 103, 179, 348, 428, 471, 492, 503, 519
LweI GCATC 1 cut(s) 494
MaeI CTAG 6 cut(s) 164, 236, 248, 375, 399, 489
MaeII ACGT 4 cut(s) 180, 265, 274, 419
MaeIII GTNAC 4 cut(s) 16, 176, 266, 305
MalI GATC 5 cut(s) 5, 30, 54, 88, 434
MboI GATC 5 cut(s) 3, 28, 52, 86, 432
MboII GAAGA 3 cut(s) 47, 233, 482
MflI RGATCY 2 cut(s) 28, 86
MluCI AATT 2 cut(s) 113, 530
MmeI TCCRAC 1 cut(s) 374
MnlI CCTC 7 cut(s) 19, 116, 244, 352, 446, 475, 485
MroXI GAANNNNTTC 1 cut(s) 207
MseI TTAA 2 cut(s) 302, 422
MspR9I CCNGG 2 cut(s) 91, 507
Mva1269I GAATGC 1 cut(s) 527
MvaI CCWGG 2 cut(s) 91, 507
MwoI GCNNNNNNNGC 3 cut(s) 359, 384, 462
NdeII GATC 5 cut(s) 3, 28, 52, 86, 432
NheI GCTAGC 1 cut(s) 374
NlaIII CATG 1 cut(s) 366
NmuCI GTSAC 1 cut(s) 305
NspI RCATGY 1 cut(s) 366
PcsI WCGNNNNNNNCGW 1 cut(s) 271
PctI GAATGC 1 cut(s) 527
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 1 cut(s) 549
PflMI CCANNNNNTGG 1 cut(s) 534
Psp1406I AACGTT 2 cut(s) 180, 265
Psp6I CCWGG 2 cut(s) 89, 505
PspGI CCWGG 2 cut(s) 89, 505
PspPI GGNCC 1 cut(s) 455
PstI CTGCAG 1 cut(s) 11
PsuI RGATCY 2 cut(s) 28, 86
RsaI GTAC 3 cut(s) 258, 367, 429
RsaNI GTAC 3 cut(s) 257, 366, 428
SaqAI TTAA 2 cut(s) 302, 422
Sau3AI GATC 5 cut(s) 3, 28, 52, 86, 432
Sau96I GGNCC 1 cut(s) 455
ScaI AGTACT 1 cut(s) 258
ScrFI CCNGG 2 cut(s) 91, 507
SfaNI GCATC 1 cut(s) 494
SfcI CTRYAG 2 cut(s) 7, 515
Sse9I AATT 2 cut(s) 113, 530
SsiI CCGC 2 cut(s) 385, 465
SspMI CTAG 6 cut(s) 164, 236, 248, 375, 399, 489
StyD4I CCNGG 2 cut(s) 89, 505
TaiI ACGT 4 cut(s) 183, 268, 277, 422
TasI AATT 2 cut(s) 113, 530
TatI WGTACW 1 cut(s) 256
TfiI GAWTC 1 cut(s) 549
Tru1I TTAA 2 cut(s) 302, 422
Tru9I TTAA 2 cut(s) 302, 422
TseFI GTSAC 1 cut(s) 305
Tsp45I GTSAC 1 cut(s) 305
TspDTI ATGAA 3 cut(s) 156, 230, 310
TspGWI ACGGA 1 cut(s) 164
Van91I CCANNNNNTGG 1 cut(s) 534
XagI CCTNNNNNAGG 1 cut(s) 479
XapI RAATTY 1 cut(s) 113
XbaI TCTAGA 1 cut(s) 247
XceI RCATGY 1 cut(s) 366
XcmI CCANNNNNNNNNTGG 1 cut(s) 346
XmnI GAANNNNTTC 1 cut(s) 207
XspI CTAG 6 cut(s) 164, 236, 248, 375, 399, 489
ZraI GACGTC 1 cut(s) 275
ZrmI AGTACT 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.