Rmu_sc0004296.1_g000006

f-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004296.1
OG0004114
Physical Location & Seq
Reverse (-)
29131 .. 29577
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004296.1_g000006.1.cds

Sequence Viewer

Length: 447 bp
atggatcatagtgttagatctagtacttctttggaaacatatcgttgtgagaagaattatcttgtggagtcaactaagggagacctattgcttgttcgaagattttctacctgggaaggtctggaaataactctgcaagctactacaacctttagggttcacaaatttgtgttccaagacaatgatttcgagctgattgaggaaacaaatattggagatgacgctctattcgtaggtgataatcattcggtgtctgttttagcttcaaactttcctatgtgcaagccaaactccatatactacacatgtgcagtacctaatgagtatggtggtaaagcatgtgagatatgtatcttcaatttagaggacggaaccataacaaaacttgattctctaaacaattcggacagttttgagtcgctttgtatctcacctaaggtggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF295 F-box F-box-like

Protein Analysis

148

Amino Acids

16.66

Weight (kDa)

4.61

Isoelectric Point (pI)

41.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 164
AfaI GTAC 2 cut(s) 25, 315
AflIII ACRYGT 1 cut(s) 305
AgsI TTSAA 2 cut(s) 267, 358
AjnI CCWGG 1 cut(s) 110
AjuI GAANNNNNNNTTGG 2 cut(s) 195, 227
AluBI AGCT 3 cut(s) 140, 193, 263
AluI AGCT 3 cut(s) 140, 193, 263
Alw26I GTCTC 1 cut(s) 75
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 1 cut(s) 164
ArsI GACNNNNNNTTYG 4 cut(s) 170, 202, 212, 244
Asp700I GAANNNNTTC 1 cut(s) 103
AsuHPI GGTGA 2 cut(s) 248, 423
AsuII TTCGAA 1 cut(s) 97
AxyI CCTNAGG 1 cut(s) 435
BarI GAAGNNNNNNTAC 2 cut(s) 91, 123
BciT130I CCWGG 1 cut(s) 112
BcoDI GTCTC 1 cut(s) 75
BfaI CTAG 1 cut(s) 21
BglII AGATCT 1 cut(s) 17
BmcAI AGTACT 1 cut(s) 25
Bme1390I CCNGG 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 373
BmrFI CCNGG 1 cut(s) 112
Bpu14I TTCGAA 1 cut(s) 97
BsaBI GATNNNNATC 1 cut(s) 350
BsaI GGTCTC 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 111
Bse21I CCTNAGG 1 cut(s) 435
Bse8I GATNNNNATC 1 cut(s) 350
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 111
BseJI GATNNNNATC 1 cut(s) 350
BsgI GTGCAG 1 cut(s) 330
BsmAI GTCTC 1 cut(s) 75
Bso31I GGTCTC 1 cut(s) 75
Bsp119I TTCGAA 1 cut(s) 97
Bsp143I GATC 2 cut(s) 4, 17
BspLI GGNNCC 1 cut(s) 373
BspPI GGATC 1 cut(s) 12
BspT104I TTCGAA 1 cut(s) 97
BspTNI GGTCTC 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 2 cut(s) 4, 17
Bst2UI CCWGG 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 410
BstBI TTCGAA 1 cut(s) 97
BstC8I GCNNGC 2 cut(s) 138, 284
BstDEI CTNAG 2 cut(s) 75, 435
BstKTI GATC 2 cut(s) 7, 20
BstMAI GTCTC 1 cut(s) 75
BstMBI GATC 2 cut(s) 4, 17
BstNI CCWGG 1 cut(s) 112
BstNSI RCATGY 2 cut(s) 309, 342
BstSCI CCNGG 1 cut(s) 110
BstX2I RGATCY 1 cut(s) 17
BstYI RGATCY 1 cut(s) 17
Bsu36I CCTNAGG 1 cut(s) 435
Cac8I GCNNGC 2 cut(s) 138, 284
CseI GACGC 1 cut(s) 230
Csp6I GTAC 2 cut(s) 24, 314
CviAII CATG 2 cut(s) 306, 339
CviJI RGCY 4 cut(s) 140, 193, 263, 286
CviKI_1 RGCY 4 cut(s) 140, 193, 263, 286
CviQI GTAC 2 cut(s) 24, 314
DdeI CTNAG 2 cut(s) 75, 435
DpnI GATC 2 cut(s) 6, 19
DpnII GATC 2 cut(s) 4, 17
Eco31I GGTCTC 1 cut(s) 75
Eco81I CCTNAGG 1 cut(s) 435
EcoRII CCWGG 1 cut(s) 110
FaeI CATG 2 cut(s) 309, 342
FatI CATG 2 cut(s) 305, 338
FspBI CTAG 1 cut(s) 21
HgaI GACGC 1 cut(s) 230
Hin1II CATG 2 cut(s) 309, 342
HincII GTYRAC 1 cut(s) 72
HindII GTYRAC 1 cut(s) 72
HinfI GANTC 3 cut(s) 68, 389, 416
HphI GGTGA 2 cut(s) 248, 423
Hpy166II GTNNAC 2 cut(s) 72, 160
Hpy188I TCNGA 1 cut(s) 406
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 2 cut(s) 72, 160
HpyAV CCTTC 1 cut(s) 110
HpyCH4III ACNGT 1 cut(s) 410
HpyCH4V TGCA 3 cut(s) 136, 282, 311
HpyF3I CTNAG 2 cut(s) 75, 435
Hsp92II CATG 2 cut(s) 309, 342
Kzo9I GATC 2 cut(s) 4, 17
LpnPI CCDG 3 cut(s) 97, 107, 124
MaeI CTAG 1 cut(s) 21
MalI GATC 2 cut(s) 6, 19
MboI GATC 2 cut(s) 4, 17
MboII GAAGA 3 cut(s) 64, 111, 346
MflI RGATCY 1 cut(s) 17
MluCI AATT 4 cut(s) 55, 164, 358, 400
MlyI GAGTC 2 cut(s) 77, 425
MnlI CCTC 2 cut(s) 193, 358
MroXI GAANNNNTTC 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
NdeII GATC 2 cut(s) 4, 17
NlaIII CATG 2 cut(s) 309, 342
NlaIV GGNNCC 1 cut(s) 373
NspI RCATGY 2 cut(s) 309, 342
NspV TTCGAA 1 cut(s) 97
PciI ACATGT 1 cut(s) 305
PcsI WCGNNNNNNNCGW 1 cut(s) 228
PdmI GAANNNNTTC 1 cut(s) 103
PfeI GAWTC 1 cut(s) 389
PleI GAGTC 2 cut(s) 76, 424
PpsI GAGTC 2 cut(s) 76, 424
PscI ACATGT 1 cut(s) 305
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 373
PsuI RGATCY 1 cut(s) 17
RsaI GTAC 2 cut(s) 25, 315
RsaNI GTAC 2 cut(s) 24, 314
Sau3AI GATC 2 cut(s) 4, 17
ScaI AGTACT 1 cut(s) 25
SchI GAGTC 2 cut(s) 77, 425
ScrFI CCNGG 1 cut(s) 112
SfuI TTCGAA 1 cut(s) 97
Sse9I AATT 4 cut(s) 55, 164, 358, 400
SspI AATATT 1 cut(s) 211
SspMI CTAG 1 cut(s) 21
StyD4I CCNGG 1 cut(s) 110
TaaI ACNGT 1 cut(s) 410
TaqI TCGA 2 cut(s) 97, 189
TasI AATT 4 cut(s) 55, 164, 358, 400
TatI WGTACW 1 cut(s) 23
TfiI GAWTC 1 cut(s) 389
TspGWI ACGGA 1 cut(s) 384
XapI RAATTY 1 cut(s) 164
XceI RCATGY 2 cut(s) 309, 342
XmnI GAANNNNTTC 1 cut(s) 103
XspI CTAG 1 cut(s) 21
ZrmI AGTACT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.