Rh2AG071600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0004114
Physical Location & Seq
Forward (+)
6000616 .. 6000909
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG071600.1

Sequence Viewer

Length: 294 bp
ATGGCAAAAGAGGCACATACCATTGCTAGTATACCCCGCAAAGGTTGGACTAGCGAGCAAATAAGGGTGGCGTTAAAGGTACTGATCAGTATACTGGACAAGAGATGCCTTGTAAGCGGGGAAGACCTCATTGAGGCAGCTAGCTCCAAAGTAAGTCCAGGTGAGCTACTGGAATATGCAATTTCAACAATGAAGAATCTGAAGTGTGTGCTGCACCAAATTGTGGCTTGTAAGGAGAATCCAATCTCAAATCTGATGGAGTATAGACTAGACTGTTCCTCTCATAACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.77

Weight (kDa)

8.39

Isoelectric Point (pI)

35.84

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
WHD_plant_repro PF25874 16 - 91 6.2e-07 Winged helix-turn-helix domain in plant reproductive proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 223
AccI GTMKAC 2 cut(s) 31, 91
AciI CCGC 2 cut(s) 37, 117
AcuI CTGAAG 1 cut(s) 221
AfaI GTAC 1 cut(s) 81
AfiI CCNNNNNNNGG 3 cut(s) 41, 133, 223
AgsI TTSAA 1 cut(s) 186
AjnI CCWGG 1 cut(s) 157
AluBI AGCT 3 cut(s) 140, 144, 166
AluI AGCT 3 cut(s) 140, 144, 166
ApeKI GCWGC 2 cut(s) 137, 211
AsuHPI GGTGA 1 cut(s) 173
AsuNHI GCTAGC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 129
BbvI GCAGC 2 cut(s) 149, 198
BccI CCATC 1 cut(s) 250
BciT130I CCWGG 1 cut(s) 159
BclI TGATCA 1 cut(s) 84
BfaI CTAG 4 cut(s) 27, 51, 141, 269
BisI GCNGC 2 cut(s) 138, 212
BlsI GCNGC 2 cut(s) 139, 213
Bme1390I CCNGG 1 cut(s) 159
BmrFI CCNGG 1 cut(s) 159
BmsI GCATC 1 cut(s) 95
BmtI GCTAGC 1 cut(s) 144
BpiI GAAGAC 1 cut(s) 129
Bsc4I CCNNNNNNNGG 3 cut(s) 41, 133, 223
Bse1I ACTGG 2 cut(s) 99, 174
Bse3DI GCAATG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 159
BseLI CCNNNNNNNGG 3 cut(s) 41, 133, 223
BseMI GCAATG 1 cut(s) 21
BseNI ACTGG 2 cut(s) 99, 174
BseXI GCAGC 2 cut(s) 149, 198
BsgI GTGCAG 1 cut(s) 197
BslI CCNNNNNNNGG 3 cut(s) 41, 133, 223
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 2 cut(s) 37, 117
BspOI GCTAGC 1 cut(s) 144
BsrDI GCAATG 1 cut(s) 21
BsrI ACTGG 2 cut(s) 99, 174
BssMI GATC 1 cut(s) 84
BssNAI GTATAC 2 cut(s) 32, 92
Bst1107I GTATAC 2 cut(s) 32, 92
Bst2UI CCWGG 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 275
BstC8I GCNNGC 2 cut(s) 56, 142
BstENI CCTNNNNNAGG 1 cut(s) 131
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstMWI GCNNNNNNNGC 2 cut(s) 11, 114
BstNI CCWGG 1 cut(s) 159
BstSCI CCNGG 1 cut(s) 157
BstV1I GCAGC 2 cut(s) 149, 198
BstV2I GAAGAC 1 cut(s) 129
BstZ17I GTATAC 2 cut(s) 32, 92
Cac8I GCNNGC 2 cut(s) 56, 142
Csp6I GTAC 1 cut(s) 80
CviJI RGCY 4 cut(s) 140, 144, 166, 227
CviKI_1 RGCY 4 cut(s) 140, 144, 166, 227
CviQI GTAC 1 cut(s) 80
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 221
EcoNI CCTNNNNNAGG 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 157
FaiI YATR 6 cut(s) 18, 32, 92, 177, 264, 285
FauI CCCGC 2 cut(s) 44, 110
FbaI TGATCA 1 cut(s) 84
FblI GTMKAC 2 cut(s) 31, 91
Fnu4HI GCNGC 2 cut(s) 138, 212
Fsp4HI GCNGC 2 cut(s) 138, 212
FspBI CTAG 4 cut(s) 27, 51, 141, 269
GluI GCNGC 2 cut(s) 138, 212
HinfI GANTC 2 cut(s) 196, 238
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 2 cut(s) 32, 92
Hpy188I TCNGA 2 cut(s) 201, 255
Hpy8I GTNNAC 2 cut(s) 32, 92
HpyCH4III ACNGT 1 cut(s) 275
HpyCH4V TGCA 2 cut(s) 179, 214
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 114
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 1 cut(s) 84
LmnI GCTCC 1 cut(s) 149
LpnPI CCDG 4 cut(s) 80, 144, 155, 171
Lsp1109I GCAGC 2 cut(s) 149, 198
LweI GCATC 1 cut(s) 95
MaeI CTAG 4 cut(s) 27, 51, 141, 269
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 2 cut(s) 134, 205
MluCI AATT 2 cut(s) 180, 219
MmeI TCCRAC 1 cut(s) 26
MnlI CCTC 4 cut(s) 4, 127, 137, 289
MseI TTAA 1 cut(s) 74
MspR9I CCNGG 1 cut(s) 159
MvaI CCWGG 1 cut(s) 159
MwoI GCNNNNNNNGC 2 cut(s) 11, 114
NdeII GATC 1 cut(s) 84
NheI GCTAGC 1 cut(s) 140
PfeI GAWTC 2 cut(s) 196, 238
PflMI CCANNNNNTGG 1 cut(s) 223
PkrI GCNGC 2 cut(s) 139, 213
Psp6I CCWGG 1 cut(s) 157
PspGI CCWGG 1 cut(s) 157
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
SaqAI TTAA 1 cut(s) 74
SatI GCNGC 2 cut(s) 138, 212
Sau3AI GATC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 159
SetI ASST 7 cut(s) 46, 81, 129, 142, 146, 163, 168
SfaNI GCATC 1 cut(s) 95
Sse9I AATT 2 cut(s) 180, 219
SsiI CCGC 2 cut(s) 37, 117
SspMI CTAG 4 cut(s) 27, 51, 141, 269
StyD4I CCNGG 1 cut(s) 157
TaaI ACNGT 1 cut(s) 275
TasI AATT 2 cut(s) 180, 219
TfiI GAWTC 2 cut(s) 196, 238
Tru1I TTAA 1 cut(s) 74
Tru9I TTAA 1 cut(s) 74
TseI GCWGC 2 cut(s) 137, 211
TspDTI ATGAA 1 cut(s) 206
Van91I CCANNNNNTGG 1 cut(s) 223
XagI CCTNNNNNAGG 1 cut(s) 131
XmiI GTMKAC 2 cut(s) 31, 91
XspI CTAG 4 cut(s) 27, 51, 141, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.