MD11G1106700.v1.1
NAC Family

Inactive rhomboid protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Reverse (-)
9440546 .. 9441438
893 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1106700.v1.1.491

Sequence Viewer

Length: 183 bp
ATGAAGCTTGATGTAATTCTGTTTTTAATCAATGTTGGACTTGGGAAACCTAGTGAATATACAAGCAAATCTACGATTAGTTATGCATCTGGATTTTTCCATGTGCTTTCCAATATGCTAAGTCTTGTATTCATTGAAATTCGGCTTGAGCAAGAATTTGGATTTGGGAAGTGGATCCTTTAA

Protein Analysis

61

Amino Acids

6.83

Weight (kDa)

6.53

Isoelectric Point (pI)

35.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 169, 182
AcsI RAATTY 2 cut(s) 138, 155
AgsI TTSAA 1 cut(s) 137
AjuI GAANNNNNNNTTGG 2 cut(s) 147, 179
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
AlwI GGATC 2 cut(s) 169, 182
ApoI RAATTY 2 cut(s) 138, 155
BamHI GGATCC 1 cut(s) 174
BfaI CTAG 1 cut(s) 51
BmiI GGNNCC 1 cut(s) 176
BmsI GCATC 1 cut(s) 95
BpuEI CTTGAG 1 cut(s) 167
Bsp143I GATC 1 cut(s) 174
BspLI GGNNCC 1 cut(s) 176
BspPI GGATC 2 cut(s) 169, 182
BssMI GATC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 1 cut(s) 177
BstMBI GATC 1 cut(s) 174
BstX2I RGATCY 1 cut(s) 174
BstYI RGATCY 1 cut(s) 174
CviAII CATG 1 cut(s) 101
CviJI RGCY 2 cut(s) 7, 145
CviKI_1 RGCY 2 cut(s) 7, 145
DdeI CTNAG 1 cut(s) 119
DpnI GATC 1 cut(s) 176
DpnII GATC 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 88
FaeI CATG 1 cut(s) 104
FaiI YATR 4 cut(s) 60, 84, 102, 116
FatI CATG 1 cut(s) 100
FspBI CTAG 1 cut(s) 51
Hin1II CATG 1 cut(s) 104
HindIII AAGCTT 1 cut(s) 5
Hpy188III TCNNGA 1 cut(s) 90
HpyCH4V TGCA 1 cut(s) 86
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 1 cut(s) 104
Kzo9I GATC 1 cut(s) 174
LpnPI CCDG 1 cut(s) 75
LweI GCATC 1 cut(s) 95
MaeI CTAG 1 cut(s) 51
MalI GATC 1 cut(s) 176
MboI GATC 1 cut(s) 174
MflI RGATCY 1 cut(s) 174
MluCI AATT 3 cut(s) 15, 138, 155
MmeI TCCRAC 1 cut(s) 16
Mph1103I ATGCAT 1 cut(s) 88
MseI TTAA 2 cut(s) 26, 181
NdeII GATC 1 cut(s) 174
NlaIII CATG 1 cut(s) 104
NlaIV GGNNCC 1 cut(s) 176
NsiI ATGCAT 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 176
PsuI RGATCY 1 cut(s) 174
SaqAI TTAA 2 cut(s) 26, 181
Sau3AI GATC 1 cut(s) 174
SetI ASST 2 cut(s) 9, 52
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 9 cut(s) 20, 53, 63, 75, 102, 113, 137, 158, 164
SmlI CTYRAG 1 cut(s) 146
SmoI CTYRAG 1 cut(s) 146
Sse9I AATT 3 cut(s) 15, 138, 155
SspMI CTAG 1 cut(s) 51
TasI AATT 3 cut(s) 15, 138, 155
Tru1I TTAA 2 cut(s) 26, 181
Tru9I TTAA 2 cut(s) 26, 181
TspDTI ATGAA 2 cut(s) 17, 121
XapI RAATTY 2 cut(s) 138, 155
XspI CTAG 1 cut(s) 51
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.