MD13G1169300.v1.1

CAP-Gly domain-containing linker protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
Physical Location & Seq
Reverse (-)
13695368 .. 13697348
1981 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1169300.v1.1.491

Sequence Viewer

Length: 429 bp
ATGGCCGCCGCCAACTCTTCTGATTCCTCGATTCCCTCCACTCCTCCTCCACTCTCCTCCAGCAAGGAGAATGTGACCCCGATTGGCTCCAAGCTTGCGGAATTGAATGAATCGAGGTCTGAGCTACTTGGTAGAATTCAAGGGTTGAAGCAGGATTTGCAAAGTTGGAGGTCGAACTTAGACACTCAAGTGAAAGTCTACCACGATGAGCTTTCAGAACTCAAGAAATCCCTCAACACTGAAGTGGATCAACTTCGATCTGAATTTCAAGATCTGAGGACCACTCTTCAGCAGCAGCAAGAGGATGTTACGACTAGTCTTAGAAACTTGGGGCTGCAGGATGTTTCAGGAGAGAAAAAAGAAGCCCAAGATACCGAAGAACCAAATGTTTCAACCAAGGTGGATGAGGCCAAAGAAGGTGAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

15.71

Weight (kDa)

4.59

Isoelectric Point (pI)

63.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 198
AciI CCGC 3 cut(s) 6, 9, 98
AclWI GGATC 1 cut(s) 255
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 2 cut(s) 135, 263
AcuI CTGAAG 2 cut(s) 261, 272
AgsI TTSAA 5 cut(s) 106, 140, 148, 269, 393
AhlI ACTAGT 1 cut(s) 314
AleI CACNNNNGTG 2 cut(s) 188, 242
AluBI AGCT 4 cut(s) 94, 124, 211, 426
AluI AGCT 4 cut(s) 94, 124, 211, 426
AlwI GGATC 1 cut(s) 255
AoxI GGCC 2 cut(s) 3, 408
ApeKI GCWGC 3 cut(s) 292, 295, 334
ApoI RAATTY 2 cut(s) 135, 263
AspS9I GGNCC 1 cut(s) 279
AvaII GGWCC 1 cut(s) 279
BbvI GCAGC 3 cut(s) 304, 307, 321
BcuI ACTAGT 1 cut(s) 314
BfaI CTAG 2 cut(s) 315, 427
BfmI CTRYAG 1 cut(s) 335
BglII AGATCT 1 cut(s) 271
BisI GCNGC 5 cut(s) 6, 9, 293, 296, 335
BlsI GCNGC 5 cut(s) 7, 10, 294, 297, 336
Bme18I GGWCC 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 279
BmiI GGNNCC 1 cut(s) 88
BplI GAGNNNNNCTC 2 cut(s) 268, 300
BpmI CTGGAG 1 cut(s) 43
BpuEI CTTGAG 2 cut(s) 171, 206
BsaJI CCNNGG 1 cut(s) 396
BsaXI ACNNNNNCTCC 2 cut(s) 31, 61
BseDI CCNNGG 1 cut(s) 396
BseGI GGATG 3 cut(s) 310, 346, 409
BseMII CTCAG 2 cut(s) 111, 266
BseRI GAGGAG 3 cut(s) 33, 36, 46
BseXI GCAGC 3 cut(s) 304, 307, 321
BshFI GGCC 2 cut(s) 5, 410
BsnI GGCC 2 cut(s) 5, 410
Bsp143I GATC 3 cut(s) 247, 257, 271
BspACI CCGC 3 cut(s) 6, 9, 98
BspANI GGCC 2 cut(s) 5, 410
BspCNI CTCAG 2 cut(s) 112, 267
BspLI GGNNCC 1 cut(s) 88
BspMAI CTGCAG 1 cut(s) 339
BspPI GGATC 1 cut(s) 255
BssECI CCNNGG 1 cut(s) 396
BssMI GATC 3 cut(s) 247, 257, 271
BssT1I CCWWGG 1 cut(s) 396
Bst6I CTCTTC 2 cut(s) 22, 291
BstAPI GCANNNNNTGC 1 cut(s) 157
BstC8I GCNNGC 1 cut(s) 96
BstDEI CTNAG 4 cut(s) 120, 178, 275, 320
BstF5I GGATG 3 cut(s) 310, 346, 409
BstKTI GATC 3 cut(s) 250, 260, 274
BstMBI GATC 3 cut(s) 247, 257, 271
BstMWI GCNNNNNNNGC 1 cut(s) 157
BstSFI CTRYAG 1 cut(s) 335
BstV1I GCAGC 3 cut(s) 304, 307, 321
BstX2I RGATCY 1 cut(s) 271
BstYI RGATCY 1 cut(s) 271
BsuRI GGCC 2 cut(s) 5, 410
BtsCI GGATG 3 cut(s) 310, 346, 409
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 279
CspCI CAANNNNNGTGG 2 cut(s) 381, 416
CviJI RGCY 9 cut(s) 5, 87, 94, 124, 211, 334, 365, 410, 426
CviKI_1 RGCY 9 cut(s) 5, 87, 94, 124, 211, 334, 365, 410, 426
DdeI CTNAG 4 cut(s) 120, 178, 275, 320
DpnI GATC 3 cut(s) 249, 259, 273
DpnII GATC 3 cut(s) 247, 257, 271
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 22, 291
EarI CTCTTC 2 cut(s) 22, 291
Eco130I CCWWGG 1 cut(s) 396
Eco47I GGWCC 1 cut(s) 279
Eco57I CTGAAG 2 cut(s) 261, 272
EcoRI GAATTC 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 396
ErhI CCWWGG 1 cut(s) 396
FblI GTMKAC 1 cut(s) 198
Fnu4HI GCNGC 5 cut(s) 6, 9, 293, 296, 335
FokI GGATG 3 cut(s) 317, 353, 416
Fsp4HI GCNGC 5 cut(s) 6, 9, 293, 296, 335
FspBI CTAG 2 cut(s) 315, 427
GluI GCNGC 5 cut(s) 6, 9, 293, 296, 335
GsuI CTGGAG 1 cut(s) 43
HaeIII GGCC 2 cut(s) 5, 410
HindIII AAGCTT 1 cut(s) 92
HinfI GANTC 3 cut(s) 23, 31, 110
Hpy166II GTNNAC 1 cut(s) 199
Hpy188I TCNGA 5 cut(s) 22, 121, 217, 262, 276
Hpy188III TCNNGA 3 cut(s) 223, 269, 348
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 1 cut(s) 410
HpyCH4V TGCA 2 cut(s) 160, 337
HpyF10VI GCNNNNNNNGC 1 cut(s) 157
HpyF3I CTNAG 4 cut(s) 120, 178, 275, 320
Kzo9I GATC 3 cut(s) 247, 257, 271
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 4 cut(s) 73, 137, 323, 333
Lsp1109I GCAGC 3 cut(s) 304, 307, 321
MaeI CTAG 2 cut(s) 315, 427
MaeIII GTNAC 2 cut(s) 73, 307
MalI GATC 3 cut(s) 249, 259, 273
MboI GATC 3 cut(s) 247, 257, 271
MboII GAAGA 3 cut(s) 9, 278, 389
MflI RGATCY 1 cut(s) 271
MluCI AATT 3 cut(s) 101, 135, 263
MmeI TCCRAC 1 cut(s) 146
MslI CAYNNNNRTG 2 cut(s) 188, 242
MwoI GCNNNNNNNGC 1 cut(s) 157
NdeII GATC 3 cut(s) 247, 257, 271
NlaIV GGNNCC 1 cut(s) 88
NmuCI GTSAC 1 cut(s) 73
OliI CACNNNNGTG 2 cut(s) 188, 242
PfeI GAWTC 3 cut(s) 23, 31, 110
PkrI GCNGC 5 cut(s) 7, 10, 294, 297, 336
PspN4I GGNNCC 1 cut(s) 88
PspPI GGNCC 1 cut(s) 279
PstI CTGCAG 1 cut(s) 339
PsuI RGATCY 1 cut(s) 271
RseI CAYNNNNRTG 2 cut(s) 188, 242
SatI GCNGC 5 cut(s) 6, 9, 293, 296, 335
Sau3AI GATC 3 cut(s) 247, 257, 271
Sau96I GGNCC 1 cut(s) 279
SetI ASST 8 cut(s) 96, 119, 126, 173, 213, 402, 421, 428
SfcI CTRYAG 1 cut(s) 335
SinI GGWCC 1 cut(s) 279
SmiMI CAYNNNNRTG 2 cut(s) 188, 242
SmlI CTYRAG 2 cut(s) 186, 221
SmoI CTYRAG 2 cut(s) 186, 221
SpeI ACTAGT 1 cut(s) 314
Sse9I AATT 3 cut(s) 101, 135, 263
SsiI CCGC 3 cut(s) 6, 9, 98
SspMI CTAG 2 cut(s) 315, 427
StyI CCWWGG 1 cut(s) 396
TaqI TCGA 4 cut(s) 29, 113, 173, 256
TasI AATT 3 cut(s) 101, 135, 263
TauI GCSGC 2 cut(s) 8, 11
TfiI GAWTC 3 cut(s) 23, 31, 110
TscAI CASTG 1 cut(s) 244
TseFI GTSAC 1 cut(s) 73
TseI GCWGC 3 cut(s) 292, 295, 334
Tsp45I GTSAC 1 cut(s) 73
TspDTI ATGAA 1 cut(s) 123
TspRI CASTG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 279
XapI RAATTY 2 cut(s) 135, 263
XmiI GTMKAC 1 cut(s) 198
XspI CTAG 2 cut(s) 315, 427
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.