Rroxscaffold_6G00405940

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
28390108 .. 28392730
2623 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00405940.1

Sequence Viewer

Length: 180 bp
ATGGCCGGAGTTCGTGGTCTTCTCGGTTGGAGTGAGAGCAGAGAGAAAGGAGATGGCTGGGTCGGACTACAGGACGTGACAGGAGATTCCAAGGTTGATGATACTGAGGTTGAAGGGAAGGATCACAAAGAATCAGATGTATCAACGCCAGAGGATGATGTTAAAGAAGCTGAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.36

Weight (kDa)

4.2

Isoelectric Point (pI)

40.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 129
AcoI YGGCCR 1 cut(s) 3
AgsI TTSAA 1 cut(s) 113
AjiI CACGTC 1 cut(s) 76
AluBI AGCT 2 cut(s) 170, 177
AluI AGCT 2 cut(s) 170, 177
AlwI GGATC 1 cut(s) 129
AoxI GGCC 1 cut(s) 3
BaeI ACNNNNGTAYC 2 cut(s) 93, 126
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 47
BfaI CTAG 1 cut(s) 178
BfmI CTRYAG 1 cut(s) 68
BmgBI CACGTC 1 cut(s) 76
BpiI GAAGAC 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 90
BseGI GGATG 1 cut(s) 160
BseMII CTCAG 1 cut(s) 96
BseYI CCCAGC 1 cut(s) 57
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 6
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 121
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 97
BspPI GGATC 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 90
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 1 cut(s) 90
BstDEI CTNAG 1 cut(s) 105
BstF5I GGATG 1 cut(s) 160
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 68
BstV2I GAAGAC 1 cut(s) 11
BsuRI GGCC 1 cut(s) 5
BtrI CACGTC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 160
CviJI RGCY 4 cut(s) 5, 57, 170, 177
CviKI_1 RGCY 4 cut(s) 5, 57, 170, 177
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 3
Eco130I CCWWGG 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FokI GGATG 1 cut(s) 167
FspBI CTAG 1 cut(s) 178
GsaI CCCAGC 1 cut(s) 61
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 6
HinfI GANTC 2 cut(s) 86, 131
HpaII CCGG 1 cut(s) 6
Hpy188I TCNGA 2 cut(s) 65, 136
HpyAV CCTTC 2 cut(s) 107, 112
HpyCH4IV ACGT 1 cut(s) 75
HpyF3I CTNAG 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 75
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 5 cut(s) 19, 43, 56, 66, 162
MaeI CTAG 1 cut(s) 178
MaeII ACGT 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MboII GAAGA 1 cut(s) 11
MmeI TCCRAC 2 cut(s) 8, 43
MnlI CCTC 2 cut(s) 100, 145
MseI TTAA 1 cut(s) 162
MspI CCGG 1 cut(s) 6
NdeII GATC 1 cut(s) 121
NmuCI GTSAC 1 cut(s) 76
PfeI GAWTC 2 cut(s) 86, 131
PspFI CCCAGC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 121
SetI ASST 5 cut(s) 78, 96, 111, 172, 179
SfcI CTRYAG 1 cut(s) 68
SgeI CNNG 9 cut(s) 18, 26, 35, 70, 83, 88, 93, 103, 161
SspMI CTAG 1 cut(s) 178
StyI CCWWGG 1 cut(s) 90
TaiI ACGT 1 cut(s) 78
TfiI GAWTC 2 cut(s) 86, 131
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TseFI GTSAC 1 cut(s) 76
Tsp45I GTSAC 1 cut(s) 76
XspI CTAG 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.