Rroxscaffold_4G00330840

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
64599687 .. 64600786
1100 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00330840.1

Sequence Viewer

Length: 177 bp
ATGTCAGTGCCTCTGGAATTAAAGACTTCTCGAACTCAAGCAATCACTCAACACTTAAGTGGGCTACAGGACGTGACAAGAGATTCCAAGGTTGATGATACTGAGGTTGAAGGGAAGGATCACAAAGAATCAGATGTATCAAACCCAGAGGATGATGTTAAAGAAGCTGAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.43

Weight (kDa)

4.43

Isoelectric Point (pI)

42.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 126
AflII CTTAAG 1 cut(s) 55
AgsI TTSAA 1 cut(s) 110
AjiI CACGTC 1 cut(s) 73
AleI CACNNNNGTG 1 cut(s) 57
AluBI AGCT 2 cut(s) 167, 174
AluI AGCT 2 cut(s) 167, 174
AlwI GGATC 1 cut(s) 126
BaeI ACNNNNGTAYC 2 cut(s) 90, 123
BfaI CTAG 1 cut(s) 175
BfmI CTRYAG 1 cut(s) 65
BfrI CTTAAG 1 cut(s) 55
BmgBI CACGTC 1 cut(s) 73
BpuEI CTTGAG 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 87
BseGI GGATG 1 cut(s) 157
BseMII CTCAG 1 cut(s) 93
Bsp143I GATC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 94
BspPI GGATC 1 cut(s) 126
BspTI CTTAAG 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 1 cut(s) 118
BssT1I CCWWGG 1 cut(s) 87
BstAFI CTTAAG 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 102
BstF5I GGATG 1 cut(s) 157
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 65
BtrI CACGTC 1 cut(s) 73
BtsCI GGATG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 12
CviJI RGCY 3 cut(s) 64, 167, 174
CviKI_1 RGCY 3 cut(s) 64, 167, 174
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
Eco130I CCWWGG 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 87
ErhI CCWWGG 1 cut(s) 87
FokI GGATG 1 cut(s) 164
FspBI CTAG 1 cut(s) 175
HinfI GANTC 2 cut(s) 83, 128
Hpy188I TCNGA 1 cut(s) 133
Hpy188III TCNNGA 2 cut(s) 14, 30
HpyAV CCTTC 2 cut(s) 104, 109
HpyCH4IV ACGT 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 102
HpySE526I ACGT 1 cut(s) 72
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 2 cut(s) 53, 159
MaeI CTAG 1 cut(s) 175
MaeII ACGT 1 cut(s) 72
MaeIII GTNAC 1 cut(s) 73
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MluCI AATT 1 cut(s) 17
MnlI CCTC 3 cut(s) 21, 97, 142
MseI TTAA 3 cut(s) 20, 56, 159
MslI CAYNNNNRTG 1 cut(s) 57
MspCI CTTAAG 1 cut(s) 55
NdeII GATC 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 73
OliI CACNNNNGTG 1 cut(s) 57
PfeI GAWTC 2 cut(s) 83, 128
RseI CAYNNNNRTG 1 cut(s) 57
SaqAI TTAA 3 cut(s) 20, 56, 159
Sau3AI GATC 1 cut(s) 118
SetI ASST 5 cut(s) 75, 93, 108, 169, 176
SfcI CTRYAG 1 cut(s) 65
SgeI CNNG 8 cut(s) 26, 42, 50, 80, 85, 90, 100, 158
SmiMI CAYNNNNRTG 1 cut(s) 57
SmlI CTYRAG 2 cut(s) 36, 55
SmoI CTYRAG 2 cut(s) 36, 55
Sse9I AATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 175
StyI CCWWGG 1 cut(s) 87
TaiI ACGT 1 cut(s) 75
TaqI TCGA 1 cut(s) 31
TasI AATT 1 cut(s) 17
TfiI GAWTC 2 cut(s) 83, 128
Tru1I TTAA 3 cut(s) 20, 56, 159
Tru9I TTAA 3 cut(s) 20, 56, 159
TscAI CASTG 1 cut(s) 12
TseFI GTSAC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 73
TspRI CASTG 1 cut(s) 12
Vha464I CTTAAG 1 cut(s) 55
XspI CTAG 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.