Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr4B

Orthogroup ID

OG0002436

Physical Location & Seq

Genomic Coordinates Forward (+)

40603059 .. 40603903

Gene Structure 845 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh4BG239600.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 237 bp

ATGAGAGTAACTAAAAGAGAGGAGGAGGTGGGCATTAGATCTGAACTTTCAGAACTCAAGCAATCGCTCAACACTGAAGTGGAGCAACTTCGATCAGAATTTCAAGAACTGAGGACCACTCTTCAGCAGCAGCAAGATGATGTAACTACTAGTCTTCGGAACTTTGGGCTACAGGACGTGACAGGAGATTCCAAGGCTGATAATACTGAGGTTGAAGGGAAGGCTCTCAAAGAATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

78

Amino Acids

8.94

Weight (kDa)

4.67

Isoelectric Point (pI)

75.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002436)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G15790 AT4G15790
fragaria_vesca	FvH4_4g17930 FvH4_4g17930 FvH4_4g17940 FvH4_4g17940 FvH4_4g17940
malus_domestica	MD13G1169200.v1.1 MD13G1169300.v1.1 MD16G1170500.v1.1
prunus_persica	Prupe.1G137600_v2.0.a1 Prupe.1G137600_v2.0.a1 Prupe.1G137600_v2.0.a1 Prupe.1G137900_v2.0.a1
pyrus_communis	pycom13g14490 pycom16g14290
rosa_chinensis	RchiOBHm_Chr4g0422101 RchiOBHm_Chr4g0422111
rosa_laevigata	RLG00000007635
rosa_multiflora	Rmu_sc0009286.1_g000003 Rmu_sc0009286.1_g000004
rosa_roxburghii	Rroxscaffold_3G00224970 Rroxscaffold_4G00330840 Rroxscaffold_5G00364180 Rroxscaffold_5G00364190 Rroxscaffold_6G00405940
rosa_rugosa	Rorug04G0177200 Rorug04G0177300 Rorug04G0177400 Rorug04G0177500
rosa_samantha	Rh4AG236800 Rh4AG236900 Rh4BG239600 Rh4BG239700 Rh4CG251500 Rh4CG251600 Rh4DG235700 Rh4DG235800 Rh6BG107100
rosa_wichuraiana	Rw4G020480 Rw4G020490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	98
AcuI	CTGAAG	2 cut(s)	96, 107
AgsI	TTSAA	2 cut(s)	104, 215
AhlI	ACTAGT	1 cut(s)	149
AjiI	CACGTC	1 cut(s)	178
AleI	CACNNNNGTG	1 cut(s)	77
ApeKI	GCWGC	2 cut(s)	127, 130
ApoI	RAATTY	1 cut(s)	98
AspS9I	GGNCC	1 cut(s)	114
AvaII	GGWCC	1 cut(s)	114
BbsI	GAAGAC	1 cut(s)	146
BbvI	GCAGC	2 cut(s)	139, 142
BcuI	ACTAGT	1 cut(s)	149
BfaI	CTAG	1 cut(s)	150
BfmI	CTRYAG	1 cut(s)	170
BglII	AGATCT	1 cut(s)	38
BisI	GCNGC	2 cut(s)	128, 131
BlsI	GCNGC	2 cut(s)	129, 132
Bme18I	GGWCC	1 cut(s)	114
BmgBI	CACGTC	1 cut(s)	178
BmgT120I	GGNCC	1 cut(s)	114
BpiI	GAAGAC	1 cut(s)	146
BplI	GAGNNNNNCTC	2 cut(s)	103, 135
BpuEI	CTTGAG	1 cut(s)	41
BsaJI	CCNNGG	1 cut(s)	192
BseDI	CCNNGG	1 cut(s)	192
BseMII	CTCAG	2 cut(s)	101, 198
BseRI	GAGGAG	2 cut(s)	35, 38
BseXI	GCAGC	2 cut(s)	139, 142
Bsp143I	GATC	2 cut(s)	38, 92
BspCNI	CTCAG	2 cut(s)	102, 199
BssECI	CCNNGG	1 cut(s)	192
BssMI	GATC	2 cut(s)	38, 92
BssT1I	CCWWGG	1 cut(s)	192
Bst6I	CTCTTC	1 cut(s)	126
BstDEI	CTNAG	2 cut(s)	110, 207
BstKTI	GATC	2 cut(s)	41, 95
BstMBI	GATC	2 cut(s)	38, 92
BstSFI	CTRYAG	1 cut(s)	170
BstV1I	GCAGC	2 cut(s)	139, 142
BstV2I	GAAGAC	1 cut(s)	146
BstX2I	RGATCY	1 cut(s)	38
BstYI	RGATCY	1 cut(s)	38
BtrI	CACGTC	1 cut(s)	178
BtsIMutI	CAGTG	1 cut(s)	72
Cfr13I	GGNCC	1 cut(s)	114
CviJI	RGCY	3 cut(s)	169, 197, 224
CviKI_1	RGCY	3 cut(s)	169, 197, 224
DdeI	CTNAG	2 cut(s)	110, 207
DpnI	GATC	2 cut(s)	40, 94
DpnII	GATC	2 cut(s)	38, 92
Eam1104I	CTCTTC	1 cut(s)	126
EarI	CTCTTC	1 cut(s)	126
Eco130I	CCWWGG	1 cut(s)	192
Eco47I	GGWCC	1 cut(s)	114
Eco57I	CTGAAG	2 cut(s)	96, 107
EcoT14I	CCWWGG	1 cut(s)	192
ErhI	CCWWGG	1 cut(s)	192
Fnu4HI	GCNGC	2 cut(s)	128, 131
Fsp4HI	GCNGC	2 cut(s)	128, 131
FspBI	CTAG	1 cut(s)	150
GluI	GCNGC	2 cut(s)	128, 131
HinfI	GANTC	1 cut(s)	188
Hpy188I	TCNGA	4 cut(s)	43, 52, 97, 159
Hpy188III	TCNNGA	1 cut(s)	104
HpyAV	CCTTC	2 cut(s)	209, 214
HpyCH4IV	ACGT	1 cut(s)	177
HpyF3I	CTNAG	2 cut(s)	110, 207
HpySE526I	ACGT	1 cut(s)	177
Kzo9I	GATC	2 cut(s)	38, 92
LmnI	GCTCC	1 cut(s)	82
LpnPI	CCDG	2 cut(s)	158, 168
Lsp1109I	GCAGC	2 cut(s)	139, 142
MaeI	CTAG	1 cut(s)	150
MaeII	ACGT	1 cut(s)	177
MaeIII	GTNAC	3 cut(s)	7, 142, 178
MalI	GATC	2 cut(s)	40, 94
MboI	GATC	2 cut(s)	38, 92
MboII	GAAGA	2 cut(s)	113, 146
MflI	RGATCY	1 cut(s)	38
MluCI	AATT	1 cut(s)	98
MnlI	CCTC	5 cut(s)	13, 16, 19, 105, 202
MslI	CAYNNNNRTG	1 cut(s)	77
NdeII	GATC	2 cut(s)	38, 92
NmuCI	GTSAC	1 cut(s)	178
OliI	CACNNNNGTG	1 cut(s)	77
PfeI	GAWTC	1 cut(s)	188
PkrI	GCNGC	2 cut(s)	129, 132
PspPI	GGNCC	1 cut(s)	114
PsuI	RGATCY	1 cut(s)	38
RseI	CAYNNNNRTG	1 cut(s)	77
SatI	GCNGC	2 cut(s)	128, 131
Sau3AI	GATC	2 cut(s)	38, 92
Sau96I	GGNCC	1 cut(s)	114
SetI	ASST	3 cut(s)	30, 180, 213
SfcI	CTRYAG	1 cut(s)	170
SgeI	CNNG	8 cut(s)	70, 116, 146, 162, 185, 190, 195, 205
SinI	GGWCC	1 cut(s)	114
SmiMI	CAYNNNNRTG	1 cut(s)	77
SmlI	CTYRAG	1 cut(s)	56
SmoI	CTYRAG	1 cut(s)	56
SpeI	ACTAGT	1 cut(s)	149
Sse9I	AATT	1 cut(s)	98
SspMI	CTAG	1 cut(s)	150
StyI	CCWWGG	1 cut(s)	192
TaiI	ACGT	1 cut(s)	180
TaqI	TCGA	1 cut(s)	91
TasI	AATT	1 cut(s)	98
TfiI	GAWTC	1 cut(s)	188
TscAI	CASTG	1 cut(s)	79
TseFI	GTSAC	1 cut(s)	178
TseI	GCWGC	2 cut(s)	127, 130
Tsp45I	GTSAC	1 cut(s)	178
TspRI	CASTG	1 cut(s)	79
VpaK11BI	GGWCC	1 cut(s)	114
XapI	RAATTY	1 cut(s)	98
XspI	CTAG	1 cut(s)	150

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.