Rroxscaffold_3G00224970

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
8229625 .. 8231330
1706 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00224970.1

Sequence Viewer

Length: 171 bp
ATGGAAGAAAACGGTTATTGCGAGAGAGAAGTTAGTAGGAAAAATGGGTTGTGGAATCTACAGGACGTGACAAGAGATTCCAAGGTTGATAATATTGAGGTTGAAGGGAAGGATCACAAAGAATCAGATGTGTCAAACCCAGAGGATGATGTTAAAGAAGCTGAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.45

Weight (kDa)

4.35

Isoelectric Point (pI)

56.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 120
AgsI TTSAA 1 cut(s) 104
AjiI CACGTC 1 cut(s) 67
AluBI AGCT 2 cut(s) 161, 168
AluI AGCT 2 cut(s) 161, 168
AlwI GGATC 1 cut(s) 120
BfaI CTAG 1 cut(s) 169
BfmI CTRYAG 1 cut(s) 59
BmgBI CACGTC 1 cut(s) 67
BsaJI CCNNGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 151
Bsp143I GATC 1 cut(s) 112
BspPI GGATC 1 cut(s) 120
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 14
BstF5I GGATG 1 cut(s) 151
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 59
BtrI CACGTC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 151
CviJI RGCY 2 cut(s) 161, 168
CviKI_1 RGCY 2 cut(s) 161, 168
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
Eco130I CCWWGG 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FokI GGATG 1 cut(s) 158
FspBI CTAG 1 cut(s) 169
HinfI GANTC 3 cut(s) 55, 77, 122
Hpy188I TCNGA 1 cut(s) 127
HpyAV CCTTC 2 cut(s) 98, 103
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4IV ACGT 1 cut(s) 66
HpySE526I ACGT 1 cut(s) 66
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 47, 153
MaeI CTAG 1 cut(s) 169
MaeII ACGT 1 cut(s) 66
MaeIII GTNAC 1 cut(s) 67
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 1 cut(s) 17
MnlI CCTC 2 cut(s) 91, 136
MseI TTAA 1 cut(s) 153
NdeII GATC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 67
PcsI WCGNNNNNNNCGW 1 cut(s) 18
PfeI GAWTC 3 cut(s) 55, 77, 122
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 1 cut(s) 112
SetI ASST 5 cut(s) 69, 87, 102, 163, 170
SfcI CTRYAG 1 cut(s) 59
SgeI CNNG 6 cut(s) 34, 74, 79, 84, 94, 152
SspI AATATT 1 cut(s) 94
SspMI CTAG 1 cut(s) 169
StyI CCWWGG 1 cut(s) 81
TaaI ACNGT 1 cut(s) 14
TaiI ACGT 1 cut(s) 69
TfiI GAWTC 3 cut(s) 55, 77, 122
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TseFI GTSAC 1 cut(s) 67
Tsp45I GTSAC 1 cut(s) 67
XspI CTAG 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.