Rh6BG107100

CAP-Gly domain-containing linker protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
16607357 .. 16608525
1169 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG107100.1

Sequence Viewer

Length: 213 bp
ATGGTTTCCCACAATCAGCTAATGGGATTGGAGGAACTTCGATCTGTAACTGTTGCTCTGGCAACACTTCAAGATGATGTAACTACTAGCCTTCGGAACTTTGGGCTACAGGACGTGACAGGATATTCCAAGGTTGATGATACTGAGGTTGAAGGGAAGGATCACAAAGAATCAGATGTATCAACCCCAGAGGATGATGTTAAAGGAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.67

Weight (kDa)

4.28

Isoelectric Point (pI)

41.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 168
AgsI TTSAA 2 cut(s) 71, 152
AjiI CACGTC 1 cut(s) 115
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
AlwI GGATC 1 cut(s) 168
BaeI ACNNNNGTAYC 2 cut(s) 132, 165
BfaI CTAG 1 cut(s) 87
BfmI CTRYAG 1 cut(s) 107
BmgBI CACGTC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 129
BseDI CCNNGG 1 cut(s) 129
BseGI GGATG 1 cut(s) 199
BseMII CTCAG 1 cut(s) 135
Bsp143I GATC 2 cut(s) 41, 160
BspCNI CTCAG 1 cut(s) 136
BspPI GGATC 1 cut(s) 168
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 2 cut(s) 41, 160
BssT1I CCWWGG 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 144
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 2 cut(s) 44, 163
BstMBI GATC 2 cut(s) 41, 160
BstSFI CTRYAG 1 cut(s) 107
BtrI CACGTC 1 cut(s) 115
BtsCI GGATG 1 cut(s) 199
CviJI RGCY 3 cut(s) 19, 90, 106
CviKI_1 RGCY 3 cut(s) 19, 90, 106
DdeI CTNAG 1 cut(s) 144
DpnI GATC 2 cut(s) 43, 162
DpnII GATC 2 cut(s) 41, 160
Eco130I CCWWGG 1 cut(s) 129
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FokI GGATG 1 cut(s) 206
FspBI CTAG 1 cut(s) 87
HinfI GANTC 1 cut(s) 170
Hpy188I TCNGA 2 cut(s) 96, 175
Hpy188III TCNNGA 1 cut(s) 71
HpyAV CCTTC 3 cut(s) 101, 146, 151
HpyCH4III ACNGT 1 cut(s) 52
HpyCH4IV ACGT 1 cut(s) 114
HpyF3I CTNAG 1 cut(s) 144
HpySE526I ACGT 1 cut(s) 114
Kzo9I GATC 2 cut(s) 41, 160
LpnPI CCDG 4 cut(s) 44, 95, 105, 201
MaeI CTAG 1 cut(s) 87
MaeII ACGT 1 cut(s) 114
MaeIII GTNAC 3 cut(s) 46, 79, 115
MalI GATC 2 cut(s) 43, 162
MboI GATC 2 cut(s) 41, 160
MnlI CCTC 3 cut(s) 25, 139, 184
MseI TTAA 1 cut(s) 201
NdeII GATC 2 cut(s) 41, 160
NmuCI GTSAC 1 cut(s) 115
PfeI GAWTC 1 cut(s) 170
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 2 cut(s) 41, 160
SetI ASST 4 cut(s) 21, 117, 135, 150
SfcI CTRYAG 1 cut(s) 107
SgeI CNNG 8 cut(s) 71, 83, 99, 122, 127, 132, 142, 200
SspMI CTAG 1 cut(s) 87
StyI CCWWGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 52
TaiI ACGT 1 cut(s) 117
TaqI TCGA 1 cut(s) 40
TfiI GAWTC 1 cut(s) 170
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
TseFI GTSAC 1 cut(s) 115
Tsp45I GTSAC 1 cut(s) 115
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.