Prupe.1G012300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
938291 .. 941402
3112 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G012300.1

Sequence Viewer

Length: 267 bp
ATGAAGAGCTTGGTTATGCACCTGCATTTGAGGAAGGCACAAAGTCTAACTGTGGCAGCCTTAGTGATATGCAACTGTCAAATGAGAAGAACAGTCATGATGATGAGTTTGAGCATGAAAGTAATGGTTACAGACTACAGTGAAAAGGCTGAAGCCAGACAAGGCCAAGATGACAATTCATATGTTGCGAATGACAAATATAATGGATACAATTATGATGATGAATGCAATTATGATGAGGAATGCGATTTTGAAGAATTGACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.23

Weight (kDa)

4.69

Isoelectric Point (pI)

57.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 30
Acc36I ACCTGC 1 cut(s) 30
AcuI CTGAAG 1 cut(s) 171
AgsI TTSAA 1 cut(s) 254
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
AoxI GGCC 1 cut(s) 163
ApeKI GCWGC 1 cut(s) 56
BbvI GCAGC 1 cut(s) 68
BciVI GTATCC 1 cut(s) 200
BfmI CTRYAG 1 cut(s) 136
BfuAI ACCTGC 1 cut(s) 30
BfuI GTATCC 1 cut(s) 200
BisI GCNGC 1 cut(s) 57
BlsI GCNGC 1 cut(s) 58
BseXI GCAGC 1 cut(s) 68
BshFI GGCC 1 cut(s) 165
BsmI GAATGC 2 cut(s) 230, 248
BsnI GGCC 1 cut(s) 165
BspANI GGCC 1 cut(s) 165
BspHI TCATGA 1 cut(s) 96
BspMI ACCTGC 1 cut(s) 30
Bst4CI ACNGT 4 cut(s) 52, 77, 94, 140
BstDEI CTNAG 1 cut(s) 61
BstSFI CTRYAG 1 cut(s) 136
BstV1I GCAGC 1 cut(s) 68
BsuI GTATCC 1 cut(s) 200
BsuRI GGCC 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 145
BveI ACCTGC 1 cut(s) 30
CciI TCATGA 1 cut(s) 96
CviAII CATG 2 cut(s) 97, 115
CviJI RGCY 5 cut(s) 9, 59, 149, 155, 165
CviKI_1 RGCY 5 cut(s) 9, 59, 149, 155, 165
DdeI CTNAG 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 171
FaeI CATG 2 cut(s) 100, 118
FaiI YATR 9 cut(s) 17, 70, 98, 116, 181, 183, 201, 216, 234
FatI CATG 2 cut(s) 96, 114
FauNDI CATATG 1 cut(s) 181
Fnu4HI GCNGC 1 cut(s) 57
Fsp4HI GCNGC 1 cut(s) 57
GluI GCNGC 1 cut(s) 57
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 2 cut(s) 100, 118
Hpy188III TCNNGA 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 28
HpyCH4III ACNGT 4 cut(s) 52, 77, 94, 140
HpyCH4V TGCA 4 cut(s) 19, 25, 72, 228
HpyF3I CTNAG 1 cut(s) 61
Hsp92II CATG 2 cut(s) 100, 118
LpnPI CCDG 2 cut(s) 35, 169
Lsp1109I GCAGC 1 cut(s) 68
MaeIII GTNAC 1 cut(s) 127
MboII GAAGA 3 cut(s) 16, 99, 266
MluCI AATT 4 cut(s) 175, 211, 229, 257
MnlI CCTC 2 cut(s) 24, 232
MseI TTAA 1 cut(s) 265
MslI CAYNNNNRTG 1 cut(s) 101
Mva1269I GAATGC 2 cut(s) 230, 248
NdeI CATATG 1 cut(s) 181
NlaIII CATG 2 cut(s) 100, 118
PagI TCATGA 1 cut(s) 96
PaqCI CACCTGC 1 cut(s) 30
PctI GAATGC 2 cut(s) 230, 248
PkrI GCNGC 1 cut(s) 58
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 265
SatI GCNGC 1 cut(s) 57
SetI ASST 2 cut(s) 11, 24
SfcI CTRYAG 1 cut(s) 136
SgeI CNNG 7 cut(s) 22, 34, 109, 127, 168, 173, 179
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 4 cut(s) 175, 211, 229, 257
TaaI ACNGT 4 cut(s) 52, 77, 94, 140
TasI AATT 4 cut(s) 175, 211, 229, 257
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
TscAI CASTG 1 cut(s) 145
TseI GCWGC 1 cut(s) 56
TspDTI ATGAA 4 cut(s) 17, 131, 168, 237
TspRI CASTG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.