Prupe.8G011600_v2.0.a1

Brf1-like TBP-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0001593
Physical Location & Seq
Reverse (-)
940593 .. 941353
761 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G011600.1

Sequence Viewer

Length: 294 bp
ATGATGCTTTGGATAAATCAAATGAAGAGCTTGGTTATGCACCTGCATTCGAAGAAGGCACAAAGTCTAATTGTGGTAGTCATGGTGATATGCAACTGTCAAATGACAAGAACAGTTTTGAAGGCAGCCATGATGATGATTTTGAGCGTGAAAGTAATGGATATAGTGAAAGAGGCTGAAGCCAGACAAGGCCATGATGATGATGATACATATGTTGCAAATGACGAATATAATGGATGCAACTACGATAACGAATACAATTACGATGATGAATGTGATTTTGATGAATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BRF1

Protein Analysis

98

Amino Acids

11.28

Weight (kDa)

4.47

Isoelectric Point (pI)

28.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 51
Acc36I ACCTGC 1 cut(s) 51
AcuI CTGAAG 1 cut(s) 198
AgsI TTSAA 1 cut(s) 121
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
AoxI GGCC 1 cut(s) 190
ApeKI GCWGC 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 97
AsuII TTCGAA 1 cut(s) 50
BaeI ACNNNNGTAYC 2 cut(s) 198, 231
BbvI GCAGC 1 cut(s) 137
BfuAI ACCTGC 1 cut(s) 51
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
BmsI GCATC 1 cut(s) 227
Bpu14I TTCGAA 1 cut(s) 50
BseGI GGATG 1 cut(s) 242
BseXI GCAGC 1 cut(s) 137
BshFI GGCC 1 cut(s) 192
BsmI GAATGC 1 cut(s) 46
BsnI GGCC 1 cut(s) 192
Bsp119I TTCGAA 1 cut(s) 50
BspANI GGCC 1 cut(s) 192
BspMI ACCTGC 1 cut(s) 51
BspQI GCTCTTC 1 cut(s) 20
BspT104I TTCGAA 1 cut(s) 50
Bst4CI ACNGT 2 cut(s) 98, 115
Bst6I CTCTTC 1 cut(s) 20
BstBI TTCGAA 1 cut(s) 50
BstF5I GGATG 1 cut(s) 242
BstV1I GCAGC 1 cut(s) 137
BsuRI GGCC 1 cut(s) 192
BtsCI GGATG 1 cut(s) 242
BveI ACCTGC 1 cut(s) 51
CviAII CATG 3 cut(s) 82, 130, 194
CviJI RGCY 5 cut(s) 30, 128, 176, 182, 192
CviKI_1 RGCY 5 cut(s) 30, 128, 176, 182, 192
Eam1104I CTCTTC 1 cut(s) 20
EarI CTCTTC 1 cut(s) 20
Eco57I CTGAAG 1 cut(s) 198
FaeI CATG 3 cut(s) 85, 133, 197
FatI CATG 3 cut(s) 81, 129, 193
FauNDI CATATG 1 cut(s) 211
Fnu4HI GCNGC 1 cut(s) 126
FokI GGATG 1 cut(s) 249
Fsp4HI GCNGC 1 cut(s) 126
GluI GCNGC 1 cut(s) 126
HaeIII GGCC 1 cut(s) 192
Hin1II CATG 3 cut(s) 85, 133, 197
HphI GGTGA 1 cut(s) 97
HpyAV CCTTC 2 cut(s) 49, 115
HpyCH4III ACNGT 2 cut(s) 98, 115
HpyCH4V TGCA 5 cut(s) 40, 46, 93, 218, 240
Hsp92II CATG 3 cut(s) 85, 133, 197
LguI GCTCTTC 1 cut(s) 20
LpnPI CCDG 2 cut(s) 56, 196
Lsp1109I GCAGC 1 cut(s) 137
LweI GCATC 1 cut(s) 227
MboII GAAGA 2 cut(s) 37, 64
MluCI AATT 3 cut(s) 69, 259, 287
MnlI CCTC 1 cut(s) 166
MslI CAYNNNNRTG 2 cut(s) 134, 198
Mva1269I GAATGC 1 cut(s) 46
NdeI CATATG 1 cut(s) 211
NlaIII CATG 3 cut(s) 85, 133, 197
NspV TTCGAA 1 cut(s) 50
PaqCI CACCTGC 1 cut(s) 51
PciSI GCTCTTC 1 cut(s) 20
PctI GAATGC 1 cut(s) 46
PkrI GCNGC 1 cut(s) 127
RseI CAYNNNNRTG 2 cut(s) 134, 198
SapI GCTCTTC 1 cut(s) 20
SatI GCNGC 1 cut(s) 126
SetI ASST 2 cut(s) 32, 45
SfaNI GCATC 1 cut(s) 227
SfuI TTCGAA 1 cut(s) 50
SgeI CNNG 9 cut(s) 43, 55, 94, 120, 142, 160, 195, 200, 206
SmiMI CAYNNNNRTG 2 cut(s) 134, 198
Sse9I AATT 3 cut(s) 69, 259, 287
TaaI ACNGT 2 cut(s) 98, 115
TaqI TCGA 1 cut(s) 50
TasI AATT 3 cut(s) 69, 259, 287
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 38, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.