Prupe.3G126200_v2.0.a1

Peptidase of plants and bacteria

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0001463
Physical Location & Seq
Forward (+)
11620108 .. 11621001
894 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G126200.1

Sequence Viewer

Length: 411 bp
ATGGAACAAACTTGCAAAGGAAATGGAGGCATTGGCGGCGAGAACACGAGTGAGGGTGATATCAAAACAGATTTCATTGGGGTATTTTGCCATGAGATGACACATACATGGCAGTGGAATGGACAGGGTCAAGCTCCTGTTGGATTGATAGAAGGGATTGCACACTTTGTGAGGTTGAAGGCGGATTATGTGCCCAATGGATGGGTAAAGTCGGGTGAAGGTCAAAGGTGGGATGAAGGTTATTTAGTGACTGCAAGGTTCCTGGACTATTGCAATGATCTTCAACAAGGGTTTGTGGCTGAACTGAACAAGAAGATGAGAGATGGCTACAGTGACAACTTCTTTCAGGAGCTGCTTGGGAAGACAGTTGATCAACTGTGGACCGACTACAAAGCTAGATTTGCAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BSP

Protein Analysis

137

Amino Acids

15.41

Weight (kDa)

4.96

Isoelectric Point (pI)

20.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 201
AciI CCGC 2 cut(s) 36, 182
AdeI CACNNNGTG 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 2 cut(s) 178, 284
AjnI CCWGG 1 cut(s) 261
AluBI AGCT 3 cut(s) 134, 352, 395
AluI AGCT 3 cut(s) 134, 352, 395
AlwNI CAGNNNCTG 1 cut(s) 352
ApeKI GCWGC 1 cut(s) 352
AspS9I GGNCC 1 cut(s) 381
AsuHPI GGTGA 2 cut(s) 68, 227
AvaII GGWCC 1 cut(s) 381
BaeGI GKGCMC 1 cut(s) 195
BauI CACGAG 1 cut(s) 46
BbsI GAAGAC 1 cut(s) 368
BbvI GCAGC 1 cut(s) 339
BccI CCATC 2 cut(s) 195, 317
BciT130I CCWGG 1 cut(s) 263
BclI TGATCA 1 cut(s) 370
BfaI CTAG 1 cut(s) 396
BfmI CTRYAG 1 cut(s) 328
BisI GCNGC 2 cut(s) 37, 353
BlsI GCNGC 2 cut(s) 38, 354
Bme1390I CCNGG 1 cut(s) 263
Bme18I GGWCC 1 cut(s) 381
BmgT120I GGNCC 1 cut(s) 381
BmiI GGNNCC 1 cut(s) 260
BmrFI CCNGG 1 cut(s) 263
BpiI GAAGAC 1 cut(s) 368
Bsc4I CCNNNNNNNGG 1 cut(s) 201
Bse3DI GCAATG 1 cut(s) 280
BseBI CCWGG 1 cut(s) 263
BseGI GGATG 2 cut(s) 206, 238
BseLI CCNNNNNNNGG 1 cut(s) 201
BseMI GCAATG 1 cut(s) 280
BseSI GKGCMC 1 cut(s) 195
BseXI GCAGC 1 cut(s) 339
BslI CCNNNNNNNGG 1 cut(s) 201
Bsp1286I GDGCHC 1 cut(s) 195
Bsp143I GATC 2 cut(s) 277, 370
BspACI CCGC 2 cut(s) 36, 182
BspLI GGNNCC 1 cut(s) 260
BsrDI GCAATG 1 cut(s) 280
BssMI GATC 2 cut(s) 277, 370
BssSI CACGAG 1 cut(s) 46
Bst2BI CACGAG 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 263
Bst4CI ACNGT 3 cut(s) 332, 367, 378
BstF5I GGATG 2 cut(s) 206, 238
BstKTI GATC 2 cut(s) 280, 373
BstMBI GATC 2 cut(s) 277, 370
BstMWI GCNNNNNNNGC 2 cut(s) 36, 401
BstNI CCWGG 1 cut(s) 263
BstSCI CCNGG 1 cut(s) 261
BstSFI CTRYAG 1 cut(s) 328
BstSLI GKGCMC 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 339
BstV2I GAAGAC 1 cut(s) 368
BtsCI GGATG 2 cut(s) 206, 238
BtsI GCAGTG 1 cut(s) 119
BtsIMutI CAGTG 2 cut(s) 119, 337
CaiI CAGNNNCTG 1 cut(s) 352
Cfr13I GGNCC 1 cut(s) 381
CviAII CATG 2 cut(s) 92, 108
CviJI RGCY 5 cut(s) 134, 299, 327, 352, 395
CviKI_1 RGCY 5 cut(s) 134, 299, 327, 352, 395
DpnI GATC 2 cut(s) 279, 372
DpnII GATC 2 cut(s) 277, 370
DraIII CACNNNGTG 1 cut(s) 169
EciI GGCGGA 1 cut(s) 197
Eco32I GATATC 1 cut(s) 61
Eco47I GGWCC 1 cut(s) 381
EcoRII CCWGG 1 cut(s) 261
EcoRV GATATC 1 cut(s) 61
FaeI CATG 2 cut(s) 95, 111
FaiI YATR 4 cut(s) 93, 105, 109, 189
FatI CATG 2 cut(s) 91, 107
FbaI TGATCA 1 cut(s) 370
Fnu4HI GCNGC 2 cut(s) 37, 353
FokI GGATG 2 cut(s) 213, 245
Fsp4HI GCNGC 2 cut(s) 37, 353
FspBI CTAG 1 cut(s) 396
GluI GCNGC 2 cut(s) 37, 353
Hin1II CATG 2 cut(s) 95, 111
HphI GGTGA 2 cut(s) 68, 227
Hpy166II GTNNAC 1 cut(s) 381
Hpy188III TCNNGA 1 cut(s) 347
Hpy8I GTNNAC 1 cut(s) 381
HpyAV CCTTC 4 cut(s) 146, 172, 212, 230
HpyCH4III ACNGT 3 cut(s) 332, 367, 378
HpyCH4V TGCA 5 cut(s) 15, 161, 254, 273, 404
HpyF10VI GCNNNNNNNGC 2 cut(s) 36, 401
Hsp92II CATG 2 cut(s) 95, 111
Ksp22I TGATCA 1 cut(s) 370
Kzo9I GATC 2 cut(s) 277, 370
LmnI GCTCC 2 cut(s) 139, 349
LpnPI CCDG 5 cut(s) 110, 150, 248, 275, 332
Lsp1109I GCAGC 1 cut(s) 339
MaeI CTAG 1 cut(s) 396
MaeIII GTNAC 2 cut(s) 247, 332
MalI GATC 2 cut(s) 279, 372
MboI GATC 2 cut(s) 277, 370
MboII GAAGA 3 cut(s) 272, 325, 373
MhlI GDGCHC 1 cut(s) 195
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 3 cut(s) 20, 46, 165
MslI CAYNNNNRTG 2 cut(s) 106, 112
MspR9I CCNGG 1 cut(s) 263
MvaI CCWGG 1 cut(s) 263
MwoI GCNNNNNNNGC 2 cut(s) 36, 401
NdeII GATC 2 cut(s) 277, 370
NlaIII CATG 2 cut(s) 95, 111
NlaIV GGNNCC 1 cut(s) 260
NmuCI GTSAC 2 cut(s) 247, 332
PflFI GACNNNGTC 1 cut(s) 126
PflMI CCANNNNNTGG 1 cut(s) 201
PfoI TCCNGGA 1 cut(s) 261
PkrI GCNGC 2 cut(s) 38, 354
Psp6I CCWGG 1 cut(s) 261
PspGI CCWGG 1 cut(s) 261
PspN4I GGNNCC 1 cut(s) 260
PspPI GGNCC 1 cut(s) 381
PstNI CAGNNNCTG 1 cut(s) 352
PsyI GACNNNGTC 1 cut(s) 126
RseI CAYNNNNRTG 2 cut(s) 106, 112
SatI GCNGC 2 cut(s) 37, 353
Sau3AI GATC 2 cut(s) 277, 370
Sau96I GGNCC 1 cut(s) 381
ScrFI CCNGG 1 cut(s) 263
SduI GDGCHC 1 cut(s) 195
SetI ASST 8 cut(s) 136, 176, 223, 230, 241, 260, 354, 397
SfcI CTRYAG 1 cut(s) 328
SinI GGWCC 1 cut(s) 381
SmiMI CAYNNNNRTG 2 cut(s) 106, 112
SsiI CCGC 2 cut(s) 36, 182
SspMI CTAG 1 cut(s) 396
StyD4I CCNGG 1 cut(s) 261
TaaI ACNGT 3 cut(s) 332, 367, 378
TaqII GACCGA 1 cut(s) 398
TauI GCSGC 1 cut(s) 39
TscAI CASTG 2 cut(s) 119, 337
TseFI GTSAC 2 cut(s) 247, 332
TseI GCWGC 1 cut(s) 352
Tsp45I GTSAC 2 cut(s) 247, 332
TspDTI ATGAA 2 cut(s) 64, 249
TspRI CASTG 2 cut(s) 119, 337
Tth111I GACNNNGTC 1 cut(s) 126
Van91I CCANNNNNTGG 1 cut(s) 201
VpaK11BI GGWCC 1 cut(s) 381
XspI CTAG 1 cut(s) 396
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.