RchiOBHm_Chr6g0254841

Peptidase of plants and bacteria

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001463
Physical Location & Seq
Forward (+)
9752539 .. 9752931
393 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22860

Sequence Viewer

Length: 393 bp
ATGTTAATTAAAATTTCTTACATCCAGGGTATAAAAGGCGACATAAAAACGGACTTCAGTGGGGTGTTATTCCATGAGATGATACACGTGTGGCAGTGGAACGGTAAGGGTCAAGCTCCCGGCGGATTAATAGAAGGAATTGCAAATTTTGTGCGGTTCAAGGCCGACTATGTTCCTAATGGGTGGGTGAAACCGGGCGAGGGTCAGCGTTGGGATGAGGGGTATTCGGTTACTGCACGATTCCTAGACTACTGCAATGGCCTCAAGCAAGGGTTTGTGGCAGAACTTAACAAGAAGATGAGAGACGGTTATAGTGACAATTTCTTTAGCCAATTGCTTGGGAAAACAGTAGATCAGCTGTGGAAAGACTACAAAGCTAAATTCGGGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BSP

Protein Analysis

130

Amino Acids

14.83

Weight (kDa)

8.95

Isoelectric Point (pI)

12.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BSP PF04450 6 - 124 8.7e-52 Peptidase of plants and bacteria
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 123, 154
AcsI RAATTY 3 cut(s) 12, 145, 380
AcuI CTGAAG 1 cut(s) 40
AcvI CACGTG 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 200
AflIII ACRYGT 2 cut(s) 85, 87
AgsI TTSAA 1 cut(s) 160
AjnI CCWGG 1 cut(s) 24
AluBI AGCT 3 cut(s) 116, 358, 377
AluI AGCT 3 cut(s) 116, 358, 377
Alw26I GTCTC 1 cut(s) 297
AoxI GGCC 2 cut(s) 162, 259
ApoI RAATTY 3 cut(s) 12, 145, 380
AseI ATTAAT 1 cut(s) 128
AsuC2I CCSGG 2 cut(s) 120, 195
AsuHPI GGTGA 1 cut(s) 199
BaeI ACNNNNGTAYC 2 cut(s) 74, 107
BbrPI CACGTG 1 cut(s) 88
BciT130I CCWGG 1 cut(s) 26
BcnI CCSGG 2 cut(s) 120, 195
BcoDI GTCTC 1 cut(s) 297
BfaI CTAG 1 cut(s) 245
Bme1390I CCNGG 3 cut(s) 26, 120, 195
BmrFI CCNGG 3 cut(s) 26, 120, 195
BpuEI CTTGAG 1 cut(s) 248
BpuMI CCSGG 2 cut(s) 120, 195
BsaAI YACGTR 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 25
Bsc4I CCNNNNNNNGG 1 cut(s) 200
Bse3DI GCAATG 1 cut(s) 262
BseBI CCWGG 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 25
BseGI GGATG 2 cut(s) 21, 220
BseLI CCNNNNNNNGG 1 cut(s) 200
BseMI GCAATG 1 cut(s) 262
BsgI GTGCAG 1 cut(s) 219
BshFI GGCC 2 cut(s) 164, 261
BsiSI CCGG 2 cut(s) 120, 194
BslI CCNNNNNNNGG 1 cut(s) 200
BsmAI GTCTC 1 cut(s) 297
BsmBI CGTCTC 1 cut(s) 297
BsnI GGCC 2 cut(s) 164, 261
Bsp143I GATC 1 cut(s) 352
BspACI CCGC 2 cut(s) 123, 154
BspANI GGCC 2 cut(s) 164, 261
BsrDI GCAATG 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 25
BssMI GATC 1 cut(s) 352
Bst2UI CCWGG 1 cut(s) 26
Bst4CI ACNGT 3 cut(s) 104, 308, 349
BstBAI YACGTR 1 cut(s) 88
BstF5I GGATG 2 cut(s) 21, 220
BstKTI GATC 1 cut(s) 355
BstMAI GTCTC 1 cut(s) 297
BstMBI GATC 1 cut(s) 352
BstNI CCWGG 1 cut(s) 26
BstSCI CCNGG 3 cut(s) 24, 118, 193
BstXI CCANNNNNNTGG 1 cut(s) 338
BsuRI GGCC 2 cut(s) 164, 261
BtsCI GGATG 2 cut(s) 21, 220
BtsI GCAGTG 1 cut(s) 101
BtsIMutI CAGTG 2 cut(s) 64, 101
CviAII CATG 1 cut(s) 74
CviJI RGCY 6 cut(s) 116, 164, 261, 330, 358, 377
CviKI_1 RGCY 6 cut(s) 116, 164, 261, 330, 358, 377
DpnI GATC 1 cut(s) 354
DpnII GATC 1 cut(s) 352
EciI GGCGGA 1 cut(s) 138
Eco57I CTGAAG 1 cut(s) 40
Eco72I CACGTG 1 cut(s) 88
EcoRII CCWGG 1 cut(s) 24
Esp3I CGTCTC 1 cut(s) 297
FaeI CATG 1 cut(s) 77
FaiI YATR 5 cut(s) 32, 44, 75, 171, 312
FatI CATG 1 cut(s) 73
FokI GGATG 2 cut(s) 8, 227
FspBI CTAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 164, 261
HapII CCGG 2 cut(s) 120, 194
Hin1II CATG 1 cut(s) 77
HinfI GANTC 1 cut(s) 240
HpaII CCGG 2 cut(s) 120, 194
HphI GGTGA 1 cut(s) 199
Hpy188III TCNNGA 1 cut(s) 385
HpyAV CCTTC 1 cut(s) 128
HpyCH4III ACNGT 3 cut(s) 104, 308, 349
HpyCH4IV ACGT 1 cut(s) 87
HpyCH4V TGCA 3 cut(s) 143, 236, 255
HpySE526I ACGT 1 cut(s) 87
Hsp92II CATG 1 cut(s) 77
Kzo9I GATC 1 cut(s) 352
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 4 cut(s) 11, 38, 133, 207
MaeI CTAG 1 cut(s) 245
MaeII ACGT 1 cut(s) 87
MaeIII GTNAC 2 cut(s) 229, 314
MalI GATC 1 cut(s) 354
MboI GATC 1 cut(s) 352
MboII GAAGA 1 cut(s) 307
MfeI CAATTG 1 cut(s) 332
MluCI AATT 7 cut(s) 6, 12, 138, 145, 319, 332, 380
MnlI CCTC 3 cut(s) 193, 211, 272
MseI TTAA 4 cut(s) 5, 9, 128, 288
MspA1I CMGCKG 1 cut(s) 358
MspI CCGG 2 cut(s) 120, 194
MspR9I CCNGG 3 cut(s) 26, 120, 195
MunI CAATTG 1 cut(s) 332
MvaI CCWGG 1 cut(s) 26
NciI CCSGG 2 cut(s) 120, 195
NdeII GATC 1 cut(s) 352
NlaIII CATG 1 cut(s) 77
NmuCI GTSAC 1 cut(s) 314
PacI TTAATTAA 1 cut(s) 9
PfeI GAWTC 1 cut(s) 240
PmaCI CACGTG 1 cut(s) 88
PmlI CACGTG 1 cut(s) 88
Ppu21I YACGTR 1 cut(s) 88
PshBI ATTAAT 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 24
PspCI CACGTG 1 cut(s) 88
PspGI CCWGG 1 cut(s) 24
PvuII CAGCTG 1 cut(s) 358
SaqAI TTAA 4 cut(s) 5, 9, 128, 288
Sau3AI GATC 1 cut(s) 352
ScrFI CCNGG 3 cut(s) 26, 120, 195
SetI ASST 4 cut(s) 90, 118, 360, 379
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
Sse9I AATT 7 cut(s) 6, 12, 138, 145, 319, 332, 380
SsiI CCGC 2 cut(s) 123, 154
SspMI CTAG 1 cut(s) 245
StyD4I CCNGG 3 cut(s) 24, 118, 193
TaaI ACNGT 3 cut(s) 104, 308, 349
TaiI ACGT 1 cut(s) 90
TasI AATT 7 cut(s) 6, 12, 138, 145, 319, 332, 380
TfiI GAWTC 1 cut(s) 240
Tru1I TTAA 4 cut(s) 5, 9, 128, 288
Tru9I TTAA 4 cut(s) 5, 9, 128, 288
TscAI CASTG 2 cut(s) 64, 101
TseFI GTSAC 1 cut(s) 314
Tsp45I GTSAC 1 cut(s) 314
TspGWI ACGGA 1 cut(s) 65
TspRI CASTG 2 cut(s) 64, 101
VspI ATTAAT 1 cut(s) 128
XapI RAATTY 3 cut(s) 12, 145, 380
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.