Prupe.6G105600_v2.0.a1

Peptidase of plants and bacteria

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
OG0001463
Physical Location & Seq
Reverse (-)
7486759 .. 7487073
315 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G105600.1

Sequence Viewer

Length: 315 bp
ATGACGCATGTATGGCAGTGGAATGGCAATGGCGGAGCTCCTAGTGGGTTAATAGAGGGCATTGCAGACTTTGTGAGGTTGAAAGCAGGCTATACGCCTGATCATTGGGTGAAAAATGGTGAGGATAATCGTTGGGACCAAGGTTATGATGTAACTGCACGGTTCCTAGACTACTGCGAGAATGTTAAAACTGAGTTTGTAGCAAATCTGAACAGGAAGATGAGATTTGGTTACAGTGTCAACTTCTTTAAAGACATCACTGGGAGGACAGTTGATCAGCTCTGGAGGGACTACAAAGCCAAATTTGGAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BSP

Protein Analysis

105

Amino Acids

12.13

Weight (kDa)

8.73

Isoelectric Point (pI)

13.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 302
AgsI TTSAA 1 cut(s) 82
AluBI AGCT 2 cut(s) 38, 280
AluI AGCT 2 cut(s) 38, 280
Alw21I GWGCWC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 302
AspS9I GGNCC 1 cut(s) 136
AsuHPI GGTGA 2 cut(s) 121, 131
AvaII GGWCC 1 cut(s) 136
BanII GRGCYC 1 cut(s) 40
Bbv12I GWGCWC 1 cut(s) 40
BclI TGATCA 2 cut(s) 100, 274
BfaI CTAG 2 cut(s) 42, 167
Bme18I GGWCC 1 cut(s) 136
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 2 cut(s) 137, 164
BmrI ACTGGG 1 cut(s) 270
BmuI ACTGGG 1 cut(s) 270
BpmI CTGGAG 1 cut(s) 304
BsaJI CCNNGG 1 cut(s) 139
Bse1I ACTGG 1 cut(s) 265
Bse3DI GCAATG 2 cut(s) 34, 60
BseDI CCNNGG 1 cut(s) 139
BseMI GCAATG 2 cut(s) 34, 60
BseMII CTCAG 1 cut(s) 183
BseNI ACTGG 1 cut(s) 265
BsgI GTGCAG 1 cut(s) 141
BsiHKAI GWGCWC 1 cut(s) 40
BslFI GGGAC 2 cut(s) 149, 302
BsmFI GGGAC 2 cut(s) 149, 302
Bsp1286I GDGCHC 1 cut(s) 40
Bsp143I GATC 2 cut(s) 100, 274
BspACI CCGC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 184
BspLI GGNNCC 2 cut(s) 137, 164
BsrDI GCAATG 2 cut(s) 34, 60
BsrI ACTGG 1 cut(s) 265
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 2 cut(s) 100, 274
BssT1I CCWWGG 1 cut(s) 139
Bst4CI ACNGT 3 cut(s) 162, 236, 271
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 192
BstKTI GATC 2 cut(s) 103, 277
BstMBI GATC 2 cut(s) 100, 274
BstMWI GCNNNNNNNGC 1 cut(s) 13
BstNSI RCATGY 1 cut(s) 11
BtsI GCAGTG 1 cut(s) 23
BtsIMutI CAGTG 3 cut(s) 23, 241, 258
Cac8I GCNNGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 136
CseI GACGC 1 cut(s) 13
CviAII CATG 1 cut(s) 8
CviJI RGCY 4 cut(s) 38, 90, 280, 299
CviKI_1 RGCY 4 cut(s) 38, 90, 280, 299
DdeI CTNAG 1 cut(s) 192
DpnI GATC 2 cut(s) 102, 276
DpnII GATC 2 cut(s) 100, 274
DraI TTTAAA 1 cut(s) 250
EciI GGCGGA 1 cut(s) 48
Ecl136II GAGCTC 1 cut(s) 38
Eco130I CCWWGG 1 cut(s) 139
Eco24I GRGCYC 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 136
Eco53kI GAGCTC 1 cut(s) 38
EcoICRI GAGCTC 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 139
EcoT38I GRGCYC 1 cut(s) 40
ErhI CCWWGG 1 cut(s) 139
FaeI CATG 1 cut(s) 11
FaiI YATR 4 cut(s) 9, 13, 93, 147
FaqI GGGAC 2 cut(s) 149, 302
FatI CATG 1 cut(s) 7
FbaI TGATCA 2 cut(s) 100, 274
FriOI GRGCYC 1 cut(s) 40
FspBI CTAG 2 cut(s) 42, 167
GsuI CTGGAG 1 cut(s) 304
HgaI GACGC 1 cut(s) 13
Hin1II CATG 1 cut(s) 11
HincII GTYRAC 1 cut(s) 241
HindII GTYRAC 1 cut(s) 241
HphI GGTGA 2 cut(s) 121, 131
Hpy166II GTNNAC 1 cut(s) 241
Hpy188I TCNGA 1 cut(s) 210
Hpy188III TCNNGA 1 cut(s) 283
Hpy8I GTNNAC 1 cut(s) 241
HpyCH4III ACNGT 3 cut(s) 162, 236, 271
HpyCH4V TGCA 2 cut(s) 65, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 13
HpyF3I CTNAG 1 cut(s) 192
Hsp92II CATG 1 cut(s) 11
Ksp22I TGATCA 2 cut(s) 100, 274
Kzo9I GATC 2 cut(s) 100, 274
LmnI GCTCC 2 cut(s) 35, 43
LpnPI CCDG 5 cut(s) 72, 111, 199, 246, 268
MaeI CTAG 2 cut(s) 42, 167
MaeIII GTNAC 2 cut(s) 151, 230
MalI GATC 2 cut(s) 102, 276
MboI GATC 2 cut(s) 100, 274
MboII GAAGA 1 cut(s) 229
MhlI GDGCHC 1 cut(s) 40
MluCI AATT 1 cut(s) 302
MnlI CCTC 5 cut(s) 49, 69, 115, 258, 279
MseI TTAA 3 cut(s) 50, 186, 249
MwoI GCNNNNNNNGC 1 cut(s) 13
NdeII GATC 2 cut(s) 100, 274
NlaIII CATG 1 cut(s) 11
NlaIV GGNNCC 2 cut(s) 137, 164
NspI RCATGY 1 cut(s) 11
Psp124BI GAGCTC 1 cut(s) 40
PspN4I GGNNCC 2 cut(s) 137, 164
PspPI GGNCC 1 cut(s) 136
SacI GAGCTC 1 cut(s) 40
SaqAI TTAA 3 cut(s) 50, 186, 249
Sau3AI GATC 2 cut(s) 100, 274
Sau96I GGNCC 1 cut(s) 136
SduI GDGCHC 1 cut(s) 40
SetI ASST 4 cut(s) 40, 80, 145, 282
SinI GGWCC 1 cut(s) 136
Sse9I AATT 1 cut(s) 302
SsiI CCGC 1 cut(s) 33
SspMI CTAG 2 cut(s) 42, 167
SstI GAGCTC 1 cut(s) 40
StyI CCWWGG 1 cut(s) 139
TaaI ACNGT 3 cut(s) 162, 236, 271
TasI AATT 1 cut(s) 302
Tru1I TTAA 3 cut(s) 50, 186, 249
Tru9I TTAA 3 cut(s) 50, 186, 249
TscAI CASTG 3 cut(s) 23, 241, 265
TspRI CASTG 3 cut(s) 23, 241, 265
VpaK11BI GGWCC 1 cut(s) 136
XapI RAATTY 1 cut(s) 302
XceI RCATGY 1 cut(s) 11
XspI CTAG 2 cut(s) 42, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.