pycom01g06300

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
OG0002157
Physical Location & Seq
Forward (+)
6484991 .. 6485296
306 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g06300.1

Sequence Viewer

Length: 306 bp
ATGAAGATCTTAGTGATTGGAGCAACTTTAATACCTGCCACGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTTCCCACAAAGCTGGCGGGTGCCTAAAACTTCCCGACATCGATTCCTCGTCTACGGTGGTCCAACGGGGTCAAAGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCAGCCATCGCTTTGCCAATTTTCCGGAAAATCGAAAAGGGTGGCCGGAGCACTATCGATTTTCGTCAACTTTCGTGGCCTCAAACCGCCACATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

102

Amino Acids

10.89

Weight (kDa)

10.41

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 43
AccB1I GGYRCC 1 cut(s) 93
AccB7I CCANNNNNTGG 1 cut(s) 196
AccI GTMKAC 1 cut(s) 125
AccIII TCCGGA 1 cut(s) 225
AciI CCGC 2 cut(s) 90, 288
AcoI YGGCCR 1 cut(s) 244
AfiI CCNNNNNNNGG 1 cut(s) 196
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw21I GWGCWC 1 cut(s) 254
Aor13HI TCCGGA 1 cut(s) 225
AoxI GGCC 2 cut(s) 244, 278
AspS9I GGNCC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 254
BccI CCATC 3 cut(s) 58, 169, 215
BciT130I CCWGG 1 cut(s) 168
BfuAI ACCTGC 1 cut(s) 43
BglII AGATCT 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 1 cut(s) 209
Bsa29I ATCGAT 2 cut(s) 114, 258
BsaJI CCNNGG 2 cut(s) 167, 298
BsaWI WCCGGW 1 cut(s) 225
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseAI TCCGGA 1 cut(s) 225
BseBI CCWGG 1 cut(s) 168
BseCI ATCGAT 2 cut(s) 114, 258
BseDI CCNNGG 2 cut(s) 167, 298
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 196
BshFI GGCC 2 cut(s) 246, 280
BshNI GGYRCC 1 cut(s) 93
BshVI ATCGAT 2 cut(s) 114, 258
BsiHKAI GWGCWC 1 cut(s) 254
BsiSI CCGG 2 cut(s) 226, 247
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 2 cut(s) 246, 280
Bsp1286I GDGCHC 1 cut(s) 254
Bsp13I TCCGGA 1 cut(s) 225
Bsp143I GATC 1 cut(s) 6
Bsp19I CCATGG 1 cut(s) 298
BspACI CCGC 2 cut(s) 90, 288
BspANI GGCC 2 cut(s) 246, 280
BspDI ATCGAT 2 cut(s) 114, 258
BspEI TCCGGA 1 cut(s) 225
BspLI GGNNCC 1 cut(s) 95
BspMI ACCTGC 1 cut(s) 43
BspT107I GGYRCC 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 167, 298
BssMI GATC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 298
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 298
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstX2I RGATCY 1 cut(s) 6
BstXI CCANNNNNNTGG 1 cut(s) 86
BstYI RGATCY 1 cut(s) 6
Bsu15I ATCGAT 2 cut(s) 114, 258
BsuRI GGCC 2 cut(s) 246, 280
BsuTUI ATCGAT 2 cut(s) 114, 258
BtgI CCRYGG 1 cut(s) 298
BtgZI GCGATG 1 cut(s) 193
BtsCI GGATG 1 cut(s) 177
BveI ACCTGC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 133
ClaI ATCGAT 2 cut(s) 114, 258
CspCI CAANNNNNGTGG 2 cut(s) 257, 292
CviAII CATG 1 cut(s) 299
CviJI RGCY 6 cut(s) 86, 180, 188, 206, 246, 280
CviKI_1 RGCY 6 cut(s) 86, 180, 188, 206, 246, 280
DdeI CTNAG 1 cut(s) 10
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EaeI YGGCCR 1 cut(s) 244
Eco130I CCWWGG 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 298
ErhI CCWWGG 1 cut(s) 298
FaeI CATG 1 cut(s) 302
FaiI YATR 2 cut(s) 295, 300
FatI CATG 1 cut(s) 298
FauI CCCGC 1 cut(s) 83
FblI GTMKAC 1 cut(s) 125
FokI GGATG 1 cut(s) 184
HaeIII GGCC 2 cut(s) 246, 280
HapII CCGG 2 cut(s) 226, 247
Hin1II CATG 1 cut(s) 302
HincII GTYRAC 1 cut(s) 269
HindII GTYRAC 1 cut(s) 269
HinfI GANTC 1 cut(s) 116
HpaII CCGG 2 cut(s) 226, 247
Hpy166II GTNNAC 3 cut(s) 56, 126, 269
Hpy188III TCNNGA 2 cut(s) 107, 226
Hpy8I GTNNAC 3 cut(s) 56, 126, 269
HpyCH4III ACNGT 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 1 cut(s) 302
Kpn2I TCCGGA 1 cut(s) 225
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 3 cut(s) 20, 169, 249
LpnPI CCDG 6 cut(s) 48, 72, 153, 180, 239, 260
LweI GCATC 1 cut(s) 209
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 16, 73
MflI RGATCY 1 cut(s) 6
MhlI GDGCHC 1 cut(s) 254
MluCI AATT 2 cut(s) 70, 219
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 2 cut(s) 130, 291
MroI TCCGGA 1 cut(s) 225
MseI TTAA 2 cut(s) 29, 304
MspI CCGG 2 cut(s) 226, 247
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NcoI CCATGG 1 cut(s) 298
NdeII GATC 1 cut(s) 6
NlaIII CATG 1 cut(s) 302
NlaIV GGNNCC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 116
PflMI CCANNNNNTGG 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 6
SaqAI TTAA 2 cut(s) 29, 304
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 168
SduI GDGCHC 1 cut(s) 254
SetI ASST 2 cut(s) 37, 88
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 133
Sse9I AATT 2 cut(s) 70, 219
SsiI CCGC 2 cut(s) 90, 288
StyD4I CCNGG 1 cut(s) 166
StyI CCWWGG 1 cut(s) 298
TaaI ACNGT 1 cut(s) 130
TaqI TCGA 3 cut(s) 114, 234, 258
TasI AATT 2 cut(s) 70, 219
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 2 cut(s) 29, 304
Tru9I TTAA 2 cut(s) 29, 304
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 73
Van91I CCANNNNNTGG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.