pycom09g08620

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0002157
Physical Location & Seq
Reverse (-)
6686653 .. 6686877
225 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g08620.1

Sequence Viewer

Length: 225 bp
ATGAAGATCTCAGTGAGTGGAGCAAATTTCATACCTGCCACGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTGCCCACGAAGCCGGCGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCCACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATTGCTTTGCCGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

75

Amino Acids

7.67

Weight (kDa)

9.9

Isoelectric Point (pI)

23.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 114
Acc36I ACCTGC 1 cut(s) 43
AccB1I GGYRCC 1 cut(s) 93
AccB7I CCANNNNNTGG 1 cut(s) 196
AciI CCGC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 204
AcsI RAATTY 1 cut(s) 25
AcyI GRCGYC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 196
AjnI CCWGG 1 cut(s) 166
AoxI GGCC 1 cut(s) 204
ApoI RAATTY 1 cut(s) 25
AspS9I GGNCC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 93
BccI CCATC 2 cut(s) 58, 169
BciT130I CCWGG 1 cut(s) 168
BfuAI ACCTGC 1 cut(s) 43
BglII AGATCT 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 1 cut(s) 209
BsaHI GRCGYC 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 126, 167
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse118I RCCGGY 1 cut(s) 86
Bse3DI GCAATG 1 cut(s) 207
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 2 cut(s) 126, 167
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMI GCAATG 1 cut(s) 207
BseMII CTCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 206
BshNI GGYRCC 1 cut(s) 93
BsiSI CCGG 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 1 cut(s) 206
Bsp143I GATC 1 cut(s) 6
BspACI CCGC 1 cut(s) 90
BspANI GGCC 1 cut(s) 206
BspCNI CTCAG 1 cut(s) 23
BspLI GGNNCC 1 cut(s) 95
BspMI ACCTGC 1 cut(s) 43
BspT107I GGYRCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 207
BsrFI RCCGGY 1 cut(s) 86
BssAI RCCGGY 1 cut(s) 86
BssECI CCNNGG 2 cut(s) 126, 167
BssMI GATC 1 cut(s) 6
BssNI GRCGYC 1 cut(s) 111
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 130
BstACI GRCGYC 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 126
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BsuRI GGCC 1 cut(s) 206
BtgI CCRYGG 1 cut(s) 126
BtsCI GGATG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 18
BveI ACCTGC 1 cut(s) 43
Cac8I GCNNGC 1 cut(s) 88
Cfr10I RCCGGY 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 133
CviJI RGCY 4 cut(s) 86, 180, 188, 206
CviKI_1 RGCY 4 cut(s) 86, 180, 188, 206
DdeI CTNAG 1 cut(s) 10
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EaeI YGGCCR 1 cut(s) 204
Eco47I GGWCC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 166
FaiI YATR 1 cut(s) 32
FauI CCCGC 1 cut(s) 83
FokI GGATG 1 cut(s) 184
HaeIII GGCC 1 cut(s) 206
HapII CCGG 1 cut(s) 87
Hin1I GRCGYC 1 cut(s) 111
HinfI GANTC 1 cut(s) 116
HpaII CCGG 1 cut(s) 87
Hpy166II GTNNAC 2 cut(s) 56, 126
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 56, 126
Hpy99I CGWCG 3 cut(s) 113, 116, 124
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4IV ACGT 1 cut(s) 111
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 111
Hsp92I GRCGYC 1 cut(s) 111
KroI GCCGGC 1 cut(s) 86
KroNI GCCGGC 1 cut(s) 88
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 2 cut(s) 20, 169
LpnPI CCDG 4 cut(s) 48, 100, 153, 180
LweI GCATC 1 cut(s) 209
MaeII ACGT 1 cut(s) 111
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 16, 73
MflI RGATCY 1 cut(s) 6
MluCI AATT 2 cut(s) 25, 70
MmeI TCCRAC 1 cut(s) 160
MroNI GCCGGC 1 cut(s) 86
MspI CCGG 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
MwoI GCNNNNNNNGC 1 cut(s) 83
NaeI GCCGGC 1 cut(s) 88
NdeII GATC 1 cut(s) 6
NgoMIV GCCGGC 1 cut(s) 86
NlaIV GGNNCC 1 cut(s) 95
PdiI GCCGGC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 116
PflMI CCANNNNNTGG 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 6
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 168
SetI ASST 3 cut(s) 37, 114, 151
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 133
Sse9I AATT 2 cut(s) 25, 70
SsiI CCGC 1 cut(s) 90
StyD4I CCNGG 1 cut(s) 166
TaaI ACNGT 1 cut(s) 130
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 114
TasI AATT 2 cut(s) 25, 70
TfiI GAWTC 1 cut(s) 116
TscAI CASTG 1 cut(s) 18
TspDTI ATGAA 2 cut(s) 17, 19
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 1 cut(s) 18
Van91I CCANNNNNTGG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 133
XapI RAATTY 1 cut(s) 25
ZraI GACGTC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.