pycom2678g00010

Protein of unknown function (DUF642)

Basic Information

Type: gene
Biological Identity
pyrus_communis
tig00002678
Physical Location & Seq
Reverse (-)
1781 .. 2086
306 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom2678g00010.1

Sequence Viewer

Length: 306 bp
ATGAAGATCTCAGTGAGTGGAGCAACTTTCATACCTGCCATGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTTCCCACAAAGCCAGCAGGTGCCTAAAACTTCCCGACATCGATTCGTCATCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATCGCTTTGTCGATTTGCCGGAAAATCAAAAAGGGTGACCCAAGCACTATTGATTTTCGTCAACTTTCGTGGCCTCCAACAGCCACATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

10.92

Weight (kDa)

10.3

Isoelectric Point (pI)

28.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 81
Acc36I ACCTGC 2 cut(s) 43, 81
AccB1I GGYRCC 1 cut(s) 93
AccB7I CCANNNNNTGG 1 cut(s) 196
AcoI YGGCCR 1 cut(s) 204
AfiI CCNNNNNNNGG 1 cut(s) 196
AjnI CCWGG 1 cut(s) 166
AoxI GGCC 2 cut(s) 204, 278
AspS9I GGNCC 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 254
AvaII GGWCC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 93
BccI CCATC 3 cut(s) 58, 169, 215
BciT130I CCWGG 1 cut(s) 168
BfuAI ACCTGC 2 cut(s) 43, 81
BglII AGATCT 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 1 cut(s) 209
Bsa29I ATCGAT 1 cut(s) 114
BsaJI CCNNGG 2 cut(s) 167, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 168
BseCI ATCGAT 1 cut(s) 114
BseDI CCNNGG 2 cut(s) 167, 298
BseGI GGATG 1 cut(s) 177
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 24
BshFI GGCC 2 cut(s) 206, 280
BshNI GGYRCC 1 cut(s) 93
BshVI ATCGAT 1 cut(s) 114
BsiSI CCGG 1 cut(s) 226
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 2 cut(s) 206, 280
Bsp143I GATC 1 cut(s) 6
Bsp19I CCATGG 1 cut(s) 298
BspANI GGCC 2 cut(s) 206, 280
BspCNI CTCAG 1 cut(s) 23
BspDI ATCGAT 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 95
BspMI ACCTGC 2 cut(s) 43, 81
BspT107I GGYRCC 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 167, 298
BssMI GATC 1 cut(s) 6
BssT1I CCWWGG 1 cut(s) 298
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 298
BstEII GGTNACC 1 cut(s) 242
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstNI CCWGG 1 cut(s) 168
BstPI GGTNACC 1 cut(s) 242
BstSCI CCNGG 1 cut(s) 166
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
Bsu15I ATCGAT 1 cut(s) 114
BsuRI GGCC 2 cut(s) 206, 280
BsuTUI ATCGAT 1 cut(s) 114
BtgI CCRYGG 1 cut(s) 298
BtgZI GCGATG 1 cut(s) 193
BtsCI GGATG 1 cut(s) 177
BtsIMutI CAGTG 1 cut(s) 18
BveI ACCTGC 2 cut(s) 43, 81
Cac8I GCNNGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 133
ClaI ATCGAT 1 cut(s) 114
CspCI CAANNNNNGTGG 2 cut(s) 257, 292
CviAII CATG 2 cut(s) 40, 299
CviJI RGCY 6 cut(s) 86, 180, 188, 206, 280, 290
CviKI_1 RGCY 6 cut(s) 86, 180, 188, 206, 280, 290
DdeI CTNAG 1 cut(s) 10
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
EaeI YGGCCR 1 cut(s) 204
Eco130I CCWWGG 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 133
Eco91I GGTNACC 1 cut(s) 242
EcoO65I GGTNACC 1 cut(s) 242
EcoRII CCWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 298
ErhI CCWWGG 1 cut(s) 298
FaeI CATG 2 cut(s) 43, 302
FaiI YATR 4 cut(s) 32, 41, 295, 300
FatI CATG 2 cut(s) 39, 298
FokI GGATG 1 cut(s) 184
HaeIII GGCC 2 cut(s) 206, 280
HapII CCGG 1 cut(s) 226
Hin1II CATG 2 cut(s) 43, 302
HincII GTYRAC 1 cut(s) 269
HindII GTYRAC 1 cut(s) 269
HinfI GANTC 1 cut(s) 116
HpaII CCGG 1 cut(s) 226
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 2 cut(s) 56, 269
Hpy188III TCNNGA 1 cut(s) 107
Hpy8I GTNNAC 2 cut(s) 56, 269
HpyCH4III ACNGT 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 10
Hsp92II CATG 2 cut(s) 43, 302
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 2 cut(s) 20, 169
LpnPI CCDG 6 cut(s) 48, 76, 100, 153, 180, 239
LweI GCATC 1 cut(s) 209
MaeIII GTNAC 1 cut(s) 242
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 16, 73
MflI RGATCY 1 cut(s) 6
MluCI AATT 1 cut(s) 70
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 1 cut(s) 291
MseI TTAA 1 cut(s) 304
MspI CCGG 1 cut(s) 226
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NcoI CCATGG 1 cut(s) 298
NdeII GATC 1 cut(s) 6
NlaIII CATG 2 cut(s) 43, 302
NlaIV GGNNCC 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 242
PaqCI CACCTGC 1 cut(s) 81
PfeI GAWTC 1 cut(s) 116
PflMI CCANNNNNTGG 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 166
PspEI GGTNACC 1 cut(s) 242
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 133
PsuI RGATCY 1 cut(s) 6
SaqAI TTAA 1 cut(s) 304
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 168
SetI ASST 3 cut(s) 37, 95, 151
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 133
Sse9I AATT 1 cut(s) 70
StyD4I CCNGG 1 cut(s) 166
StyI CCWWGG 1 cut(s) 298
TaaI ACNGT 1 cut(s) 130
TaqI TCGA 2 cut(s) 114, 218
TasI AATT 1 cut(s) 70
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 304
Tru9I TTAA 1 cut(s) 304
TscAI CASTG 1 cut(s) 18
TseFI GTSAC 1 cut(s) 242
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 3 cut(s) 17, 19, 56
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 1 cut(s) 18
Van91I CCANNNNNTGG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.