pycom09g12760

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
OG0002157
Physical Location & Seq
Forward (+)
11319868 .. 11320134
267 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom09g12760.1

Sequence Viewer

Length: 267 bp
ATGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTGCCCACAAAGCCGGTGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATCGCTTTGTCAATTTGCCGGAAAATCGAAAAGGGTGGACGAAGCACTATTGATTTTTGTCAACTTTCGTGGCCTCAAATTGCCACATCCCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

89

Amino Acids

9.37

Weight (kDa)

9.95

Isoelectric Point (pI)

32.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 75
AccB1I GGYRCC 1 cut(s) 54
AccB7I CCANNNNNTGG 1 cut(s) 157
AccI GTMKAC 1 cut(s) 86
AcoI YGGCCR 1 cut(s) 165
AcyI GRCGYC 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 157
AjnI CCWGG 1 cut(s) 127
AoxI GGCC 2 cut(s) 165, 239
AspS9I GGNCC 1 cut(s) 94
AvaII GGWCC 1 cut(s) 94
BanI GGYRCC 1 cut(s) 54
BccI CCATC 3 cut(s) 19, 130, 176
BciT130I CCWGG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 129
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 56
BmrFI CCNGG 1 cut(s) 129
BmsI GCATC 1 cut(s) 170
BsaHI GRCGYC 1 cut(s) 72
BsaJI CCNNGG 2 cut(s) 128, 259
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse118I RCCGGY 1 cut(s) 47
BseBI CCWGG 1 cut(s) 129
BseDI CCNNGG 2 cut(s) 128, 259
BseGI GGATG 2 cut(s) 138, 254
BseLI CCNNNNNNNGG 1 cut(s) 157
BshFI GGCC 2 cut(s) 167, 241
BshNI GGYRCC 1 cut(s) 54
BsiSI CCGG 2 cut(s) 48, 187
BslI CCNNNNNNNGG 1 cut(s) 157
BsnI GGCC 2 cut(s) 167, 241
Bsp19I CCATGG 1 cut(s) 259
BspANI GGCC 2 cut(s) 167, 241
BspLI GGNNCC 1 cut(s) 56
BspT107I GGYRCC 1 cut(s) 54
BsrFI RCCGGY 1 cut(s) 47
BssAI RCCGGY 1 cut(s) 47
BssECI CCNNGG 2 cut(s) 128, 259
BssNI GRCGYC 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 259
Bst2UI CCWGG 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 91
BstACI GRCGYC 1 cut(s) 72
BstDSI CCRYGG 1 cut(s) 259
BstF5I GGATG 2 cut(s) 138, 254
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNI CCWGG 1 cut(s) 129
BstSCI CCNGG 1 cut(s) 127
BsuRI GGCC 2 cut(s) 167, 241
BtgI CCRYGG 1 cut(s) 259
BtgZI GCGATG 1 cut(s) 154
BtsCI GGATG 2 cut(s) 138, 254
Cfr10I RCCGGY 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 94
CspCI CAANNNNNGTGG 4 cut(s) 31, 66, 218, 253
CviAII CATG 1 cut(s) 260
CviJI RGCY 5 cut(s) 47, 141, 149, 167, 241
CviKI_1 RGCY 5 cut(s) 47, 141, 149, 167, 241
EaeI YGGCCR 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 259
Eco47I GGWCC 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 127
EcoT14I CCWWGG 1 cut(s) 259
ErhI CCWWGG 1 cut(s) 259
FaeI CATG 1 cut(s) 263
FaiI YATR 1 cut(s) 261
FatI CATG 1 cut(s) 259
FblI GTMKAC 1 cut(s) 86
FokI GGATG 2 cut(s) 145, 241
HaeIII GGCC 2 cut(s) 167, 241
HapII CCGG 2 cut(s) 48, 187
Hin1I GRCGYC 1 cut(s) 72
Hin1II CATG 1 cut(s) 263
HincII GTYRAC 1 cut(s) 230
HindII GTYRAC 1 cut(s) 230
HinfI GANTC 1 cut(s) 77
HpaII CCGG 2 cut(s) 48, 187
Hpy166II GTNNAC 4 cut(s) 17, 87, 206, 230
Hpy188III TCNNGA 1 cut(s) 68
Hpy8I GTNNAC 4 cut(s) 17, 87, 206, 230
Hpy99I CGWCG 3 cut(s) 74, 77, 85
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4IV ACGT 1 cut(s) 72
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpySE526I ACGT 1 cut(s) 72
Hsp92I GRCGYC 1 cut(s) 72
Hsp92II CATG 1 cut(s) 263
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 4 cut(s) 61, 114, 141, 200
LweI GCATC 1 cut(s) 170
MaeII ACGT 1 cut(s) 72
MboII GAAGA 1 cut(s) 34
MluCI AATT 3 cut(s) 31, 180, 246
MmeI TCCRAC 1 cut(s) 121
MnlI CCTC 1 cut(s) 252
MseI TTAA 1 cut(s) 265
MspI CCGG 2 cut(s) 48, 187
MspR9I CCNGG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 129
MwoI GCNNNNNNNGC 1 cut(s) 44
NcoI CCATGG 1 cut(s) 259
NlaIII CATG 1 cut(s) 263
NlaIV GGNNCC 1 cut(s) 56
PfeI GAWTC 1 cut(s) 77
PflMI CCANNNNNTGG 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 127
PspGI CCWGG 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 56
PspPI GGNCC 1 cut(s) 94
SaqAI TTAA 1 cut(s) 265
Sau96I GGNCC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 129
SetI ASST 2 cut(s) 75, 112
SfaNI GCATC 1 cut(s) 170
SgeI CNNG 9 cut(s) 60, 80, 113, 119, 140, 141, 164, 199, 249
SinI GGWCC 1 cut(s) 94
Sse9I AATT 3 cut(s) 31, 180, 246
StyD4I CCNGG 1 cut(s) 127
StyI CCWWGG 1 cut(s) 259
TaaI ACNGT 1 cut(s) 91
TaiI ACGT 1 cut(s) 75
TaqI TCGA 2 cut(s) 75, 195
TasI AATT 3 cut(s) 31, 180, 246
TfiI GAWTC 1 cut(s) 77
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 34
Van91I CCANNNNNTGG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 94
XcmI CCANNNNNNNNNTGG 1 cut(s) 47
XmiI GTMKAC 1 cut(s) 86
ZraI GACGTC 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.