Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr13

Orthogroup ID

OG0002157

Physical Location & Seq

Genomic Coordinates Reverse (-)

17706147 .. 17706452

Gene Structure 306 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom13g21300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 306 bp

ATGAAGATCTCAGTGAGTGGAGCAACTTTCATACCTTCCACGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTTCCCACGAAGCCGGCGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAAGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGAATCGGCCATTGCTTTGCCGATTTGCCGGAAAATCGAGAAGGGTGGCCGGAGCACCATTGATTTTCGTCAACTTTCGTGGCCTCAAACTTCCACATCCCATGGTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF642

Protein Analysis

102

Amino Acids

10.83

Weight (kDa)

9.94

Isoelectric Point (pI)

38.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002157)

Species	Orthologous Gene IDs
pyrus_communis	pycom01g01120 pycom01g02960 pycom01g03890 pycom01g04450 pycom01g06300 pycom02g16270 pycom02g19830 pycom04g00010 pycom04g08340 pycom04g10700 pycom05g10900 pycom07g10640 pycom07g20810 pycom07g22760 pycom08g01230 pycom08g04230 pycom08g10660 pycom08g11150 pycom09g08170 pycom09g08620 pycom09g12760 pycom09g12940 pycom09g13460 pycom09g14230 pycom09g20030 pycom10g04080 pycom11g16510 pycom11g20560 pycom11g26710 pycom12411g00040 pycom12g03500 pycom13g21300 pycom14g04190 pycom14g16640 pycom15g00190 pycom16g09280 pycom16g09680 pycom17g16810 pycom17g16950 pycom17g17060 pycom17g18580 pycom17g18950 pycom17g28010 pycom2678g00010

Species

Orthologous Gene IDs

pyrus_communis

pycom01g01120 pycom01g02960 pycom01g03890 pycom01g04450 pycom01g06300 pycom02g16270 pycom02g19830 pycom04g00010 pycom04g08340 pycom04g10700 pycom05g10900 pycom07g10640 pycom07g20810 pycom07g22760 pycom08g01230 pycom08g04230 pycom08g10660 pycom08g11150 pycom09g08170 pycom09g08620 pycom09g12760 pycom09g12940 pycom09g13460 pycom09g14230 pycom09g20030 pycom10g04080 pycom11g16510 pycom11g20560 pycom11g26710 pycom12411g00040 pycom12g03500 pycom13g21300 pycom14g04190 pycom14g16640 pycom15g00190 pycom16g09280 pycom16g09680 pycom17g16810 pycom17g16950 pycom17g17060 pycom17g18580 pycom17g18950 pycom17g28010 pycom2678g00010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	114
AccB1I	GGYRCC	1 cut(s)	93
AccB7I	CCANNNNNTGG	1 cut(s)	196
AccI	GTMKAC	1 cut(s)	125
AciI	CCGC	1 cut(s)	90
AcoI	YGGCCR	2 cut(s)	204, 244
AcyI	GRCGYC	1 cut(s)	111
AfiI	CCNNNNNNNGG	1 cut(s)	196
AjnI	CCWGG	1 cut(s)	166
Alw21I	GWGCWC	1 cut(s)	254
AoxI	GGCC	3 cut(s)	204, 244, 278
AspS9I	GGNCC	1 cut(s)	133
AvaII	GGWCC	1 cut(s)	133
BanI	GGYRCC	1 cut(s)	93
Bbv12I	GWGCWC	1 cut(s)	254
BccI	CCATC	2 cut(s)	58, 169
BciT130I	CCWGG	1 cut(s)	168
BglII	AGATCT	1 cut(s)	6
Bme1390I	CCNGG	1 cut(s)	168
Bme18I	GGWCC	1 cut(s)	133
BmgT120I	GGNCC	1 cut(s)	133
BmiI	GGNNCC	1 cut(s)	95
BmrFI	CCNGG	1 cut(s)	168
BsaHI	GRCGYC	1 cut(s)	111
BsaJI	CCNNGG	2 cut(s)	167, 298
Bsc4I	CCNNNNNNNGG	1 cut(s)	196
Bse118I	RCCGGY	1 cut(s)	86
Bse3DI	GCAATG	1 cut(s)	207
BseBI	CCWGG	1 cut(s)	168
BseDI	CCNNGG	2 cut(s)	167, 298
BseGI	GGATG	2 cut(s)	177, 293
BseLI	CCNNNNNNNGG	1 cut(s)	196
BseMI	GCAATG	1 cut(s)	207
BseMII	CTCAG	1 cut(s)	24
BshFI	GGCC	3 cut(s)	206, 246, 280
BshNI	GGYRCC	1 cut(s)	93
BsiHKAI	GWGCWC	1 cut(s)	254
BsiSI	CCGG	3 cut(s)	87, 226, 247
BslI	CCNNNNNNNGG	1 cut(s)	196
BsnI	GGCC	3 cut(s)	206, 246, 280
Bsp1286I	GDGCHC	1 cut(s)	254
Bsp143I	GATC	1 cut(s)	6
Bsp19I	CCATGG	1 cut(s)	298
BspACI	CCGC	1 cut(s)	90
BspANI	GGCC	3 cut(s)	206, 246, 280
BspCNI	CTCAG	1 cut(s)	23
BspLI	GGNNCC	1 cut(s)	95
BspT107I	GGYRCC	1 cut(s)	93
BsrDI	GCAATG	1 cut(s)	207
BsrFI	RCCGGY	1 cut(s)	86
BssAI	RCCGGY	1 cut(s)	86
BssECI	CCNNGG	2 cut(s)	167, 298
BssMI	GATC	1 cut(s)	6
BssNI	GRCGYC	1 cut(s)	111
BssT1I	CCWWGG	1 cut(s)	298
Bst2UI	CCWGG	1 cut(s)	168
Bst4CI	ACNGT	1 cut(s)	130
BstACI	GRCGYC	1 cut(s)	111
BstC8I	GCNNGC	1 cut(s)	88
BstDEI	CTNAG	1 cut(s)	10
BstDSI	CCRYGG	1 cut(s)	298
BstF5I	GGATG	2 cut(s)	177, 293
BstKTI	GATC	1 cut(s)	9
BstMBI	GATC	1 cut(s)	6
BstNI	CCWGG	1 cut(s)	168
BstSCI	CCNGG	1 cut(s)	166
BstX2I	RGATCY	1 cut(s)	6
BstYI	RGATCY	1 cut(s)	6
BsuRI	GGCC	3 cut(s)	206, 246, 280
BtgI	CCRYGG	1 cut(s)	298
BtsCI	GGATG	2 cut(s)	177, 293
BtsIMutI	CAGTG	1 cut(s)	18
Cac8I	GCNNGC	1 cut(s)	88
Cfr10I	RCCGGY	1 cut(s)	86
Cfr13I	GGNCC	1 cut(s)	133
CspCI	CAANNNNNGTGG	2 cut(s)	257, 292
CviAII	CATG	1 cut(s)	299
CviJI	RGCY	6 cut(s)	86, 180, 188, 206, 246, 280
CviKI_1	RGCY	6 cut(s)	86, 180, 188, 206, 246, 280
DdeI	CTNAG	1 cut(s)	10
DpnI	GATC	1 cut(s)	8
DpnII	GATC	1 cut(s)	6
EaeI	YGGCCR	2 cut(s)	204, 244
Eco130I	CCWWGG	1 cut(s)	298
Eco47I	GGWCC	1 cut(s)	133
EcoRII	CCWGG	1 cut(s)	166
EcoT14I	CCWWGG	1 cut(s)	298
ErhI	CCWWGG	1 cut(s)	298
FaeI	CATG	1 cut(s)	302
FaiI	YATR	2 cut(s)	32, 300
FatI	CATG	1 cut(s)	298
FauI	CCCGC	1 cut(s)	83
FblI	GTMKAC	1 cut(s)	125
FokI	GGATG	2 cut(s)	184, 280
HaeIII	GGCC	3 cut(s)	206, 246, 280
HapII	CCGG	3 cut(s)	87, 226, 247
Hin1I	GRCGYC	1 cut(s)	111
Hin1II	CATG	1 cut(s)	302
HincII	GTYRAC	1 cut(s)	269
HindII	GTYRAC	1 cut(s)	269
HinfI	GANTC	2 cut(s)	116, 200
HpaII	CCGG	3 cut(s)	87, 226, 247
Hpy166II	GTNNAC	3 cut(s)	56, 126, 269
Hpy188III	TCNNGA	2 cut(s)	107, 235
Hpy8I	GTNNAC	3 cut(s)	56, 126, 269
Hpy99I	CGWCG	3 cut(s)	113, 116, 124
HpyAV	CCTTC	2 cut(s)	45, 232
HpyCH4III	ACNGT	1 cut(s)	130
HpyCH4IV	ACGT	1 cut(s)	111
HpyF3I	CTNAG	1 cut(s)	10
HpySE526I	ACGT	1 cut(s)	111
Hsp92I	GRCGYC	1 cut(s)	111
Hsp92II	CATG	1 cut(s)	302
KroI	GCCGGC	1 cut(s)	86
KroNI	GCCGGC	1 cut(s)	88
Kzo9I	GATC	1 cut(s)	6
LmnI	GCTCC	3 cut(s)	20, 169, 249
LpnPI	CCDG	5 cut(s)	100, 153, 180, 239, 260
MaeII	ACGT	1 cut(s)	111
MalI	GATC	1 cut(s)	8
MboI	GATC	1 cut(s)	6
MboII	GAAGA	2 cut(s)	16, 73
MflI	RGATCY	1 cut(s)	6
MhlI	GDGCHC	1 cut(s)	254
MluCI	AATT	1 cut(s)	70
MmeI	TCCRAC	1 cut(s)	160
MnlI	CCTC	1 cut(s)	291
MroNI	GCCGGC	1 cut(s)	86
MseI	TTAA	1 cut(s)	304
MspI	CCGG	3 cut(s)	87, 226, 247
MspR9I	CCNGG	1 cut(s)	168
MvaI	CCWGG	1 cut(s)	168
NaeI	GCCGGC	1 cut(s)	88
NcoI	CCATGG	1 cut(s)	298
NdeII	GATC	1 cut(s)	6
NgoMIV	GCCGGC	1 cut(s)	86
NlaIII	CATG	1 cut(s)	302
NlaIV	GGNNCC	1 cut(s)	95
PdiI	GCCGGC	1 cut(s)	88
PfeI	GAWTC	2 cut(s)	116, 200
PflMI	CCANNNNNTGG	1 cut(s)	196
Psp6I	CCWGG	1 cut(s)	166
PspGI	CCWGG	1 cut(s)	166
PspN4I	GGNNCC	1 cut(s)	95
PspPI	GGNCC	1 cut(s)	133
PsuI	RGATCY	1 cut(s)	6
SaqAI	TTAA	1 cut(s)	304
Sau3AI	GATC	1 cut(s)	6
Sau96I	GGNCC	1 cut(s)	133
ScrFI	CCNGG	1 cut(s)	168
SduI	GDGCHC	1 cut(s)	254
SetI	ASST	2 cut(s)	37, 114
SinI	GGWCC	1 cut(s)	133
Sse9I	AATT	1 cut(s)	70
SsiI	CCGC	1 cut(s)	90
StyD4I	CCNGG	1 cut(s)	166
StyI	CCWWGG	1 cut(s)	298
TaaI	ACNGT	1 cut(s)	130
TaiI	ACGT	1 cut(s)	114
TaqI	TCGA	2 cut(s)	114, 234
TasI	AATT	1 cut(s)	70
TfiI	GAWTC	2 cut(s)	116, 200
Tru1I	TTAA	1 cut(s)	304
Tru9I	TTAA	1 cut(s)	304
TscAI	CASTG	1 cut(s)	18
TspDTI	ATGAA	2 cut(s)	17, 19
TspGWI	ACGGA	1 cut(s)	73
TspRI	CASTG	1 cut(s)	18
Van91I	CCANNNNNTGG	1 cut(s)	196
VpaK11BI	GGWCC	1 cut(s)	133
XmiI	GTMKAC	1 cut(s)	125
ZraI	GACGTC	1 cut(s)	112

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.