pycom08g01230

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0002157
Physical Location & Seq
Forward (+)
915051 .. 915293
243 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g01230.1

Sequence Viewer

Length: 243 bp
ATGGTCAATTTTGCCCACAAAGCCGACGGGTGCCTAAAACTTCCCGGTGTCGATTCGTCTTCTACAGTGGTCCAATGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGACGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATCACTTTGCCGATTTTCCGGAAAATCAAAAAGAGTGGCCGGAGCACCGTTGATTTTCGTCGACTTTCGTGGCCTCAAACCGCCACATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

81

Amino Acids

8.71

Weight (kDa)

10.22

Isoelectric Point (pI)

30.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 30
AccB7I CCANNNNNTGG 1 cut(s) 133
AccI GTMKAC 1 cut(s) 205
AccIII TCCGGA 1 cut(s) 162
AciI CCGC 1 cut(s) 225
AcoI YGGCCR 2 cut(s) 141, 181
AfiI CCNNNNNNNGG 1 cut(s) 133
AjnI CCWGG 1 cut(s) 103
Alw21I GWGCWC 1 cut(s) 191
Aor13HI TCCGGA 1 cut(s) 162
AoxI GGCC 3 cut(s) 141, 181, 215
AspS9I GGNCC 1 cut(s) 70
AsuC2I CCSGG 1 cut(s) 45
AvaII GGWCC 1 cut(s) 70
BanI GGYRCC 1 cut(s) 30
BbsI GAAGAC 1 cut(s) 51
Bbv12I GWGCWC 1 cut(s) 191
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 105
BcnI CCSGG 1 cut(s) 45
BfmI CTRYAG 1 cut(s) 63
Bme1390I CCNGG 2 cut(s) 45, 105
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 32
BmrFI CCNGG 2 cut(s) 45, 105
BmsI GCATC 1 cut(s) 146
BpiI GAAGAC 1 cut(s) 51
BpuMI CCSGG 1 cut(s) 45
BsaJI CCNNGG 2 cut(s) 104, 235
BsaWI WCCGGW 1 cut(s) 162
Bsc4I CCNNNNNNNGG 1 cut(s) 133
BseAI TCCGGA 1 cut(s) 162
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 2 cut(s) 104, 235
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 133
BshFI GGCC 3 cut(s) 143, 183, 217
BshNI GGYRCC 1 cut(s) 30
BsiHKAI GWGCWC 1 cut(s) 191
BsiSI CCGG 3 cut(s) 45, 163, 184
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 3 cut(s) 143, 183, 217
Bsp1286I GDGCHC 1 cut(s) 191
Bsp13I TCCGGA 1 cut(s) 162
Bsp19I CCATGG 1 cut(s) 235
BspACI CCGC 1 cut(s) 225
BspANI GGCC 3 cut(s) 143, 183, 217
BspEI TCCGGA 1 cut(s) 162
BspLI GGNNCC 1 cut(s) 32
BspT107I GGYRCC 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 104, 235
BssT1I CCWWGG 1 cut(s) 235
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 2 cut(s) 67, 193
BstDSI CCRYGG 1 cut(s) 235
BstF5I GGATG 1 cut(s) 114
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 2 cut(s) 43, 103
BstSFI CTRYAG 1 cut(s) 63
BstV2I GAAGAC 1 cut(s) 51
BsuRI GGCC 3 cut(s) 143, 183, 217
BtgI CCRYGG 1 cut(s) 235
BtsCI GGATG 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 70
CspCI CAANNNNNGTGG 2 cut(s) 160, 195
CviAII CATG 1 cut(s) 236
CviJI RGCY 6 cut(s) 23, 117, 125, 143, 183, 217
CviKI_1 RGCY 6 cut(s) 23, 117, 125, 143, 183, 217
EaeI YGGCCR 2 cut(s) 141, 181
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaeI CATG 1 cut(s) 239
FaiI YATR 2 cut(s) 232, 237
FatI CATG 1 cut(s) 235
FblI GTMKAC 1 cut(s) 205
FokI GGATG 1 cut(s) 121
HaeIII GGCC 3 cut(s) 143, 183, 217
HapII CCGG 3 cut(s) 45, 163, 184
Hin1II CATG 1 cut(s) 239
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HinfI GANTC 1 cut(s) 53
HpaII CCGG 3 cut(s) 45, 163, 184
Hpy166II GTNNAC 1 cut(s) 206
Hpy188III TCNNGA 1 cut(s) 163
Hpy8I GTNNAC 1 cut(s) 206
Hpy99I CGWCG 2 cut(s) 29, 207
HpyCH4III ACNGT 2 cut(s) 67, 193
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Hsp92II CATG 1 cut(s) 239
Kpn2I TCCGGA 1 cut(s) 162
LmnI GCTCC 2 cut(s) 106, 186
LpnPI CCDG 5 cut(s) 58, 90, 117, 176, 197
LweI GCATC 1 cut(s) 146
MboII GAAGA 1 cut(s) 51
MhlI GDGCHC 1 cut(s) 191
MluCI AATT 1 cut(s) 7
MnlI CCTC 1 cut(s) 228
MroI TCCGGA 1 cut(s) 162
MseI TTAA 1 cut(s) 241
MspI CCGG 3 cut(s) 45, 163, 184
MspR9I CCNGG 2 cut(s) 45, 105
MvaI CCWGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 20
NciI CCSGG 1 cut(s) 45
NcoI CCATGG 1 cut(s) 235
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 53
PflMI CCANNNNNTGG 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 70
SalI GTCGAC 1 cut(s) 204
SaqAI TTAA 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 2 cut(s) 45, 105
SduI GDGCHC 1 cut(s) 191
SetI ASST 1 cut(s) 88
SfaNI GCATC 1 cut(s) 146
SfcI CTRYAG 1 cut(s) 63
SinI GGWCC 1 cut(s) 70
Sse9I AATT 1 cut(s) 7
SsiI CCGC 1 cut(s) 225
StyD4I CCNGG 2 cut(s) 43, 103
StyI CCWWGG 1 cut(s) 235
TaaI ACNGT 2 cut(s) 67, 193
TaqI TCGA 2 cut(s) 51, 205
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
TscAI CASTG 1 cut(s) 72
TspRI CASTG 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 70
XmiI GTMKAC 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.