pycom02g16270

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
OG0002157
Physical Location & Seq
Reverse (-)
13405590 .. 13405832
243 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g16270.1

Sequence Viewer

Length: 243 bp
ATGGTCAATTTTGCCCACAAAGTCGGCGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATCGCTTTGCCGATTTGCCGGAAAATCGAAAAGGGTGGCCGAAGCACCATTGATTTTCGTCAACTTTTGTGGCCTCAAACCGCCCCATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

81

Amino Acids

8.65

Weight (kDa)

9.69

Isoelectric Point (pI)

40.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 51
AccB1I GGYRCC 1 cut(s) 30
AccB7I CCANNNNNTGG 2 cut(s) 133, 236
AccI GTMKAC 1 cut(s) 62
AciI CCGC 2 cut(s) 27, 225
AcoI YGGCCR 2 cut(s) 141, 181
AcyI GRCGYC 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 133, 236
AjnI CCWGG 1 cut(s) 103
AoxI GGCC 3 cut(s) 141, 181, 215
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BanI GGYRCC 1 cut(s) 30
BccI CCATC 2 cut(s) 106, 152
BciT130I CCWGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 105
BmsI GCATC 1 cut(s) 146
BsaHI GRCGYC 1 cut(s) 48
BsaJI CCNNGG 2 cut(s) 104, 235
Bsc4I CCNNNNNNNGG 2 cut(s) 133, 236
BseBI CCWGG 1 cut(s) 105
BseDI CCNNGG 2 cut(s) 104, 235
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 2 cut(s) 133, 236
BshFI GGCC 3 cut(s) 143, 183, 217
BshNI GGYRCC 1 cut(s) 30
BsiSI CCGG 1 cut(s) 163
BslI CCNNNNNNNGG 2 cut(s) 133, 236
BsnI GGCC 3 cut(s) 143, 183, 217
Bsp19I CCATGG 1 cut(s) 235
BspACI CCGC 2 cut(s) 27, 225
BspANI GGCC 3 cut(s) 143, 183, 217
BspLI GGNNCC 1 cut(s) 32
BspT107I GGYRCC 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 104, 235
BssNI GRCGYC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 235
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 67
BstACI GRCGYC 1 cut(s) 48
BstDSI CCRYGG 1 cut(s) 235
BstF5I GGATG 1 cut(s) 114
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BsuRI GGCC 3 cut(s) 143, 183, 217
BtgI CCRYGG 1 cut(s) 235
BtgZI GCGATG 1 cut(s) 130
BtsCI GGATG 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 70
CspCI CAANNNNNGTGG 2 cut(s) 194, 229
CviAII CATG 1 cut(s) 236
CviJI RGCY 5 cut(s) 117, 125, 143, 183, 217
CviKI_1 RGCY 5 cut(s) 117, 125, 143, 183, 217
EaeI YGGCCR 2 cut(s) 141, 181
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaeI CATG 1 cut(s) 239
FaiI YATR 2 cut(s) 232, 237
FatI CATG 1 cut(s) 235
FauI CCCGC 1 cut(s) 20
FblI GTMKAC 1 cut(s) 62
FokI GGATG 1 cut(s) 121
HaeIII GGCC 3 cut(s) 143, 183, 217
HapII CCGG 1 cut(s) 163
Hin1I GRCGYC 1 cut(s) 48
Hin1II CATG 1 cut(s) 239
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HinfI GANTC 1 cut(s) 53
HpaII CCGG 1 cut(s) 163
Hpy166II GTNNAC 2 cut(s) 63, 206
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 2 cut(s) 63, 206
Hpy99I CGWCG 3 cut(s) 50, 53, 61
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 48
Hsp92I GRCGYC 1 cut(s) 48
Hsp92II CATG 1 cut(s) 239
LmnI GCTCC 1 cut(s) 106
LpnPI CCDG 3 cut(s) 90, 117, 176
LweI GCATC 1 cut(s) 146
MaeII ACGT 1 cut(s) 48
MluCI AATT 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 1 cut(s) 228
MseI TTAA 1 cut(s) 241
MspI CCGG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
NcoI CCATGG 1 cut(s) 235
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 53
PflMI CCANNNNNTGG 2 cut(s) 133, 236
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 70
SaqAI TTAA 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 105
SetI ASST 2 cut(s) 51, 88
SfaNI GCATC 1 cut(s) 146
SgeI CNNG 8 cut(s) 40, 56, 89, 95, 116, 117, 140, 175
SinI GGWCC 1 cut(s) 70
Sse9I AATT 1 cut(s) 7
SsiI CCGC 2 cut(s) 27, 225
StyD4I CCNGG 1 cut(s) 103
StyI CCWWGG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 1 cut(s) 51
TaqI TCGA 2 cut(s) 51, 171
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
Van91I CCANNNNNTGG 2 cut(s) 133, 236
VpaK11BI GGWCC 1 cut(s) 70
XmiI GTMKAC 1 cut(s) 62
ZraI GACGTC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.