pycom16g09280

Protein of unknown function (DUF642)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0002157
Physical Location & Seq
Forward (+)
6207015 .. 6207257
243 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g09280.1

Sequence Viewer

Length: 243 bp
ATGGTCAATTTTGCCCACAAAGCCGGCGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCTTGGGATAATAGGCCACAAAGCCCAAGTGGTGGCATCAGCCATCGCTTTGCCGATTTGCTGGAAAATCGAAAAGGGTGGCCGGAGCACTATTGATTTTCGTCAACTTTCGTGGCCTCAAACCGCCACATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF642

Protein Analysis

81

Amino Acids

8.58

Weight (kDa)

9.51

Isoelectric Point (pI)

41.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 51
AccB1I GGYRCC 1 cut(s) 30
AccB7I CCANNNNNTGG 1 cut(s) 133
AccI GTMKAC 1 cut(s) 62
AciI CCGC 2 cut(s) 27, 225
AcoI YGGCCR 1 cut(s) 181
AcyI GRCGYC 1 cut(s) 48
AfiI CCNNNNNNNGG 1 cut(s) 133
Alw21I GWGCWC 1 cut(s) 191
AoxI GGCC 3 cut(s) 115, 181, 215
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BanI GGYRCC 1 cut(s) 30
Bbv12I GWGCWC 1 cut(s) 191
BccI CCATC 1 cut(s) 152
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 32
BmsI GCATC 1 cut(s) 146
BsaHI GRCGYC 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 235
Bsc4I CCNNNNNNNGG 1 cut(s) 133
Bse118I RCCGGY 1 cut(s) 23
BseDI CCNNGG 1 cut(s) 235
BseLI CCNNNNNNNGG 1 cut(s) 133
BshFI GGCC 3 cut(s) 117, 183, 217
BshNI GGYRCC 1 cut(s) 30
BsiHKAI GWGCWC 1 cut(s) 191
BsiSI CCGG 2 cut(s) 24, 184
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 3 cut(s) 117, 183, 217
Bsp1286I GDGCHC 1 cut(s) 191
Bsp19I CCATGG 1 cut(s) 235
BspACI CCGC 2 cut(s) 27, 225
BspANI GGCC 3 cut(s) 117, 183, 217
BspLI GGNNCC 1 cut(s) 32
BspT107I GGYRCC 1 cut(s) 30
BsrFI RCCGGY 1 cut(s) 23
BssAI RCCGGY 1 cut(s) 23
BssECI CCNNGG 1 cut(s) 235
BssNI GRCGYC 1 cut(s) 48
BssT1I CCWWGG 1 cut(s) 235
Bst4CI ACNGT 1 cut(s) 67
BstACI GRCGYC 1 cut(s) 48
BstC8I GCNNGC 1 cut(s) 25
BstDSI CCRYGG 1 cut(s) 235
BstMWI GCNNNNNNNGC 1 cut(s) 20
BsuRI GGCC 3 cut(s) 117, 183, 217
BtgI CCRYGG 1 cut(s) 235
BtgZI GCGATG 1 cut(s) 130
Cac8I GCNNGC 1 cut(s) 25
Cfr10I RCCGGY 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 70
CspCI CAANNNNNGTGG 2 cut(s) 194, 229
CviAII CATG 1 cut(s) 236
CviJI RGCY 6 cut(s) 23, 117, 125, 143, 183, 217
CviKI_1 RGCY 6 cut(s) 23, 117, 125, 143, 183, 217
EaeI YGGCCR 1 cut(s) 181
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 70
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaeI CATG 1 cut(s) 239
FaiI YATR 2 cut(s) 232, 237
FatI CATG 1 cut(s) 235
FauI CCCGC 1 cut(s) 20
FblI GTMKAC 1 cut(s) 62
HaeIII GGCC 3 cut(s) 117, 183, 217
HapII CCGG 2 cut(s) 24, 184
Hin1I GRCGYC 1 cut(s) 48
Hin1II CATG 1 cut(s) 239
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HinfI GANTC 1 cut(s) 53
HpaII CCGG 2 cut(s) 24, 184
Hpy166II GTNNAC 2 cut(s) 63, 206
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 2 cut(s) 63, 206
Hpy99I CGWCG 3 cut(s) 50, 53, 61
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4IV ACGT 1 cut(s) 48
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
HpySE526I ACGT 1 cut(s) 48
Hsp92I GRCGYC 1 cut(s) 48
Hsp92II CATG 1 cut(s) 239
KroI GCCGGC 1 cut(s) 23
KroNI GCCGGC 1 cut(s) 25
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 3 cut(s) 37, 148, 197
LweI GCATC 1 cut(s) 146
MaeII ACGT 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 191
MluCI AATT 1 cut(s) 7
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 1 cut(s) 228
MroNI GCCGGC 1 cut(s) 23
MseI TTAA 1 cut(s) 241
MspI CCGG 2 cut(s) 24, 184
MwoI GCNNNNNNNGC 1 cut(s) 20
NaeI GCCGGC 1 cut(s) 25
NcoI CCATGG 1 cut(s) 235
NgoMIV GCCGGC 1 cut(s) 23
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 32
PdiI GCCGGC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 53
PflMI CCANNNNNTGG 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 70
SaqAI TTAA 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 70
SduI GDGCHC 1 cut(s) 191
SetI ASST 2 cut(s) 51, 88
SfaNI GCATC 1 cut(s) 146
SinI GGWCC 1 cut(s) 70
Sse9I AATT 1 cut(s) 7
SsiI CCGC 2 cut(s) 27, 225
StyI CCWWGG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 67
TaiI ACGT 1 cut(s) 51
TaqI TCGA 2 cut(s) 51, 171
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
Van91I CCANNNNNTGG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 70
XmiI GTMKAC 1 cut(s) 62
ZraI GACGTC 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.