pycom01g08420

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
9342313 .. 9342516
204 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g08420.1

Sequence Viewer

Length: 204 bp
ATGCTTAACATGGGTATCCCACATGGTGCCTCCTGGTCTTCTCTTTCACCACTCGGTGAAGCCTGCTCAAGAAGGGATTTGACTGCTTTACATGATATCCTAGAGAATATCGGCTATAAAGACAATGGAATGACAAATGAGGTCCTATTTTTGTTTAATAAATGGAGAAATAAATATCTAATAAGTTGTGTTGTATATATTTAG

Protein Analysis

68

Amino Acids

7.62

Weight (kDa)

6.7

Isoelectric Point (pI)

46.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_BSK1_C PF25575 20 - 57 3.1e-08 Serine/threonine-protein kinase BSK1-like, TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 26
AdeI CACNNNGTG 2 cut(s) 26, 56
AjnI CCWGG 1 cut(s) 32
AspS9I GGNCC 1 cut(s) 142
AsuHPI GGTGA 2 cut(s) 39, 68
AvaII GGWCC 1 cut(s) 142
BaeI ACNNNNGTAYC 1 cut(s) 31
BanI GGYRCC 1 cut(s) 26
BbsI GAAGAC 1 cut(s) 30
BciT130I CCWGG 1 cut(s) 34
BciVI GTATCC 1 cut(s) 26
BfaI CTAG 1 cut(s) 101
BfuI GTATCC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 34
Bme18I GGWCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 142
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 34
BpiI GAAGAC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 34
BshNI GGYRCC 1 cut(s) 26
BspLI GGNNCC 1 cut(s) 28
BspT107I GGYRCC 1 cut(s) 26
Bst2UI CCWGG 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 64
BstNI CCWGG 1 cut(s) 34
BstSCI CCNGG 1 cut(s) 32
BstV2I GAAGAC 1 cut(s) 30
BsuI GTATCC 1 cut(s) 26
Cac8I GCNNGC 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 142
CviAII CATG 3 cut(s) 10, 23, 92
CviJI RGCY 2 cut(s) 62, 114
CviKI_1 RGCY 2 cut(s) 62, 114
DraIII CACNNNGTG 2 cut(s) 26, 56
Eco32I GATATC 1 cut(s) 97
Eco47I GGWCC 1 cut(s) 142
EcoO109I RGGNCCY 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 32
EcoRV GATATC 1 cut(s) 97
FaeI CATG 3 cut(s) 13, 26, 95
FaiI YATR 6 cut(s) 11, 24, 93, 117, 196, 198
FatI CATG 3 cut(s) 9, 22, 91
FspBI CTAG 1 cut(s) 101
Hin1II CATG 3 cut(s) 13, 26, 95
HphI GGTGA 2 cut(s) 39, 68
Hpy188III TCNNGA 1 cut(s) 69
HpyAV CCTTC 1 cut(s) 66
Hsp92II CATG 3 cut(s) 13, 26, 95
LpnPI CCDG 3 cut(s) 19, 46, 76
MaeI CTAG 1 cut(s) 101
MboII GAAGA 1 cut(s) 30
MnlI CCTC 2 cut(s) 40, 133
MseI TTAA 2 cut(s) 6, 156
MspR9I CCNGG 1 cut(s) 34
MvaI CCWGG 1 cut(s) 34
NlaIII CATG 3 cut(s) 13, 26, 95
NlaIV GGNNCC 1 cut(s) 28
PpuMI RGGWCCY 1 cut(s) 142
Psp5II RGGWCCY 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 32
PspGI CCWGG 1 cut(s) 32
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 1 cut(s) 142
PspPPI RGGWCCY 1 cut(s) 142
SaqAI TTAA 2 cut(s) 6, 156
Sau96I GGNCC 1 cut(s) 142
ScrFI CCNGG 1 cut(s) 34
SetI ASST 1 cut(s) 144
SgeI CNNG 9 cut(s) 22, 35, 45, 46, 65, 75, 81, 104, 113
SinI GGWCC 1 cut(s) 142
SmlI CTYRAG 1 cut(s) 67
SmoI CTYRAG 1 cut(s) 67
SspMI CTAG 1 cut(s) 101
StyD4I CCNGG 1 cut(s) 32
Tru1I TTAA 2 cut(s) 6, 156
Tru9I TTAA 2 cut(s) 6, 156
VpaK11BI GGWCC 1 cut(s) 142
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.