Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0004868

Physical Location & Seq

Genomic Coordinates Forward (+)

12361333 .. 12362937

Gene Structure 1605 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ55443

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGGTTTCTCCGATAGTTTTTGCACGCCGTAGTTTGTCTTATCTCATGAGTGAAATGCCACAGGAAGCCTTGAATAATGCATCACAAGCCCAAGTGATTTCCCCTATGGCACATTGCATCCTATATGCAAGCTGCAGCTCTTTTTTTACTTGGAAGGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0004675 GO:0004888 GO:0005575 GO:0005623 GO:0005886 GO:0005911 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0007154 GO:0007165 GO:0007166 GO:0007167 GO:0007178 GO:0008150 GO:0008152 GO:0009506 GO:0009719 GO:0009725 GO:0009741 GO:0009742 GO:0009755 GO:0009987 GO:0010033 GO:0014070 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019199 GO:0019538 GO:0023052 GO:0030054 GO:0032870 GO:0033993 GO:0036211 GO:0038023 GO:0042221 GO:0043170 GO:0043401 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0048545 GO:0050789 GO:0050794 GO:0050896 GO:0051716 GO:0055044 GO:0060089 GO:0065007 GO:0070887 GO:0071310 GO:0071367 GO:0071383 GO:0071396 GO:0071407 GO:0071495 GO:0071704 GO:0071944 GO:0140096 GO:1901564 GO:1901700 GO:1901701

KEGG Pathways

Metabolic & Signaling

ko04075 map04075

Pfam Domains

Protein Families

Pkinase_Tyr

Protein Analysis

53

Amino Acids

5.9

Weight (kDa)

7.82

Isoelectric Point (pI)

86.34

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
TPR_BSK1_C	PF25575	1 - 42	9.4e-13	Serine/threonine-protein kinase BSK1-like, TPR repeats

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004868)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g14100
malus_domestica	MD01G1056900.v1.1 MD14G1186200.v1.1 MD14G1186400.v1.1 MD14G1186600.v1.1
pyrus_communis	pycom01g08300 pycom01g08310 pycom01g08390 pycom01g08420 pycom01g08480 pycom01g08650 pycom01g08680 pycom01g08710 pycom02g23240
rosa_chinensis	RchiOBHm_Chr1g0324601 RchiOBHm_Chr1g0354681 RchiOBHm_Chr1g0354861
rosa_laevigata	RLG00000028186
rosa_multiflora	Rmu_sc0003940.1_g000003 Rmu_sc0006632.1_g000017
rosa_roxburghii	Rroxscaffold_4G00325320
rosa_rugosa	Rorug01G0244200 Rorug01G0244200 Rorug01G0244300
rosa_samantha	Rh1AG255200 Rh1AG256400 Rh1BG225700 Rh1CG239700
rosa_wichuraiana	Rw1G022330 Rw1G022370 Rw1G022400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	73
AluBI	AGCT	2 cut(s)	132, 138
AluI	AGCT	2 cut(s)	132, 138
ApeKI	GCWGC	2 cut(s)	132, 135
BbvI	GCAGC	2 cut(s)	119, 147
BceAI	ACGGC	1 cut(s)	12
BfmI	CTRYAG	1 cut(s)	133
BisI	GCNGC	2 cut(s)	133, 136
BlsI	GCNGC	2 cut(s)	134, 137
BmsI	GCATC	2 cut(s)	89, 126
Bse3DI	GCAATG	1 cut(s)	112
BseGI	GGATG	1 cut(s)	117
BseMI	GCAATG	1 cut(s)	112
BseXI	GCAGC	2 cut(s)	119, 147
BspHI	TCATGA	1 cut(s)	45
BspMAI	CTGCAG	1 cut(s)	137
BsrDI	GCAATG	1 cut(s)	112
BstC8I	GCNNGC	2 cut(s)	25, 130
BstF5I	GGATG	1 cut(s)	117
BstMWI	GCNNNNNNNGC	1 cut(s)	86
BstSFI	CTRYAG	1 cut(s)	133
BstV1I	GCAGC	2 cut(s)	119, 147
BtsCI	GGATG	1 cut(s)	117
Cac8I	GCNNGC	2 cut(s)	25, 130
CciI	TCATGA	1 cut(s)	45
CviAII	CATG	1 cut(s)	46
CviJI	RGCY	4 cut(s)	68, 89, 132, 138
CviKI_1	RGCY	4 cut(s)	68, 89, 132, 138
EcoT22I	ATGCAT	1 cut(s)	82
FaeI	CATG	1 cut(s)	49
FaiI	YATR	4 cut(s)	47, 107, 124, 126
FatI	CATG	1 cut(s)	45
Fnu4HI	GCNGC	2 cut(s)	133, 136
FokI	GGATG	1 cut(s)	104
Fsp4HI	GCNGC	2 cut(s)	133, 136
GluI	GCNGC	2 cut(s)	133, 136
Hin1II	CATG	1 cut(s)	49
Hpy188I	TCNGA	1 cut(s)	12
Hpy188III	TCNNGA	1 cut(s)	46
HpyAV	CCTTC	1 cut(s)	148
HpyCH4V	TGCA	5 cut(s)	23, 80, 117, 128, 135
HpyF10VI	GCNNNNNNNGC	1 cut(s)	86
Hsp92II	CATG	1 cut(s)	49
LpnPI	CCDG	1 cut(s)	47
Lsp1109I	GCAGC	2 cut(s)	119, 147
LweI	GCATC	2 cut(s)	89, 126
Mph1103I	ATGCAT	1 cut(s)	82
MwoI	GCNNNNNNNGC	1 cut(s)	86
NlaIII	CATG	1 cut(s)	49
NsiI	ATGCAT	1 cut(s)	82
PagI	TCATGA	1 cut(s)	45
PkrI	GCNGC	2 cut(s)	134, 137
PstI	CTGCAG	1 cut(s)	137
SatI	GCNGC	2 cut(s)	133, 136
SetI	ASST	2 cut(s)	134, 140
SfaNI	GCATC	2 cut(s)	89, 126
SfcI	CTRYAG	1 cut(s)	133
SgeI	CNNG	7 cut(s)	36, 58, 74, 82, 98, 104, 141
TseI	GCWGC	2 cut(s)	132, 135
Zsp2I	ATGCAT	1 cut(s)	82

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.