pycom01g08710

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
9645144 .. 9645335
192 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g08710.1

Sequence Viewer

Length: 192 bp
ATGAGTGACAAGCCTCAGGAAGCTATAAACGATGCAATGCAAGCACAAGTAGTTTCCCCACTTTGGCACATTGCATGTTATCTTCAGGCTGTTACCCTTTCGGCCCTTGGAATGGACATTGAAGCTCAAGCAACACTTAAGGAGGGTACTACGCTTGAATCCAAAAGGAGTAAAGCAGTTGGAAAAAAGTGA

Protein Analysis

64

Amino Acids

6.8

Weight (kDa)

6.54

Isoelectric Point (pI)

67.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPR_BSK1_C PF25575 1 - 30 6e-10 Serine/threonine-protein kinase BSK1-like, TPR repeats
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 68
AfaI GTAC 1 cut(s) 148
AfiI CCNNNNNNNGG 2 cut(s) 63, 112
AflII CTTAAG 1 cut(s) 137
AgsI TTSAA 2 cut(s) 122, 158
AluBI AGCT 2 cut(s) 23, 125
AluI AGCT 2 cut(s) 23, 125
AoxI GGCC 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 103
AxyI CCTNAGG 1 cut(s) 15
BfrI CTTAAG 1 cut(s) 137
BmgT120I GGNCC 1 cut(s) 103
BmsI GCATC 1 cut(s) 22
BpuEI CTTGAG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 106
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 112
Bse21I CCTNAGG 1 cut(s) 15
Bse3DI GCAATG 2 cut(s) 42, 69
BseDI CCNNGG 1 cut(s) 106
BseLI CCNNNNNNNGG 2 cut(s) 63, 112
BseMI GCAATG 2 cut(s) 42, 69
BseMII CTCAG 1 cut(s) 29
BshFI GGCC 1 cut(s) 104
BslI CCNNNNNNNGG 2 cut(s) 63, 112
BsnI GGCC 1 cut(s) 104
BspANI GGCC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 28
BspTI CTTAAG 1 cut(s) 137
BsrDI GCAATG 2 cut(s) 42, 69
BssECI CCNNGG 1 cut(s) 106
BssT1I CCWWGG 1 cut(s) 106
BstAFI CTTAAG 1 cut(s) 137
BstC8I GCNNGC 1 cut(s) 42
BstDEI CTNAG 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNSI RCATGY 1 cut(s) 78
Bsu36I CCTNAGG 1 cut(s) 15
BsuRI GGCC 1 cut(s) 104
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 103
Csp6I GTAC 1 cut(s) 147
CviAII CATG 1 cut(s) 75
CviJI RGCY 5 cut(s) 13, 23, 89, 104, 125
CviKI_1 RGCY 5 cut(s) 13, 23, 89, 104, 125
CviQI GTAC 1 cut(s) 147
DdeI CTNAG 1 cut(s) 15
Eco130I CCWWGG 1 cut(s) 106
Eco57I CTGAAG 1 cut(s) 68
Eco81I CCTNAGG 1 cut(s) 15
EcoT14I CCWWGG 1 cut(s) 106
ErhI CCWWGG 1 cut(s) 106
FaeI CATG 1 cut(s) 78
FaiI YATR 2 cut(s) 26, 76
FalI AAGNNNNNCTT 2 cut(s) 120, 152
FatI CATG 1 cut(s) 74
HaeIII GGCC 1 cut(s) 104
Hin1II CATG 1 cut(s) 78
HinfI GANTC 1 cut(s) 158
Hpy188III TCNNGA 1 cut(s) 17
HpyCH4V TGCA 3 cut(s) 35, 40, 74
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
HpyF3I CTNAG 1 cut(s) 15
Hsp92II CATG 1 cut(s) 78
LpnPI CCDG 2 cut(s) 2, 71
LweI GCATC 1 cut(s) 22
MaeIII GTNAC 2 cut(s) 5, 91
MboII GAAGA 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 2 cut(s) 24, 136
MseI TTAA 1 cut(s) 138
MspCI CTTAAG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 41
NlaIII CATG 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 5
NspI RCATGY 1 cut(s) 78
PfeI GAWTC 1 cut(s) 158
PspPI GGNCC 1 cut(s) 103
RsaI GTAC 1 cut(s) 148
RsaNI GTAC 1 cut(s) 147
SaqAI TTAA 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 103
SetI ASST 2 cut(s) 25, 127
SfaNI GCATC 1 cut(s) 22
SgeI CNNG 9 cut(s) 22, 29, 53, 59, 87, 98, 119, 140, 167
SmlI CTYRAG 2 cut(s) 126, 137
SmoI CTYRAG 2 cut(s) 126, 137
StyI CCWWGG 1 cut(s) 106
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
TseFI GTSAC 1 cut(s) 5
Tsp45I GTSAC 1 cut(s) 5
Vha464I CTTAAG 1 cut(s) 137
XceI RCATGY 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.