pycom04g19350

Acetyltransferase (GNAT) domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0001211
Physical Location & Seq
Forward (+)
21097149 .. 21097658
510 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g19350.1

Sequence Viewer

Length: 510 bp
ATGGACTCAAAATTGATCGCTCTCCGGCCATTCAAGCTATCCGACGCCGATGATCTCATGTCATACGCCGGAGATGATCAAGTGATGGATCGATCCCTCCGATGGAAGACGTTGACAACCAAAGACGAAGCGTTGACTTTCATCAAGGATGTTTGCATCCCCCACCCTTGGCGCCGGTCAATATGCATCGAAGACCGTTCGATCGGATTCGTAACCGTCTTTCCAGGATCAGGTGATGACAGGCATAAGGCAGATTTAGGGTATGCCATAGCTGCAAAGTATTGGGGCCAAGGGATAACCACCAAAGCAGTTGAGGTTGCGATCTCTCAAGTTTTCAAGGACTTCCCTAATTTGGTCAGGTTGCAAGGTTTTGCTGACTTGGAGAACAAGGTATCTCAGAGGGTTTTGGAGAAAGCTGGGTTCCAAAAGGAGGGTGTGTTGAGGAGATATGGATATCTCAAGGGAAATATAAAAGATTTGGTAAGTTATAGTTTGCTATCAACAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Acetyltransf_3

Protein Analysis

170

Amino Acids

19.08

Weight (kDa)

8.47

Isoelectric Point (pI)

42.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Acetyltransf_3 PF13302 7 - 142 2.1e-22 Acetyltransferase (GNAT) domain
Acetyltransf_1 PF00583 61 - 141 5.4e-07 Acetyltransferase (GNAT) family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 171
AclWI GGATC 3 cut(s) 87, 96, 235
AcoI YGGCCR 1 cut(s) 26
AcyI GRCGYC 2 cut(s) 45, 172
AfiI CCNNNNNNNGG 5 cut(s) 102, 168, 230, 352, 430
AgsI TTSAA 2 cut(s) 34, 337
AjnI CCWGG 1 cut(s) 223
AluBI AGCT 3 cut(s) 37, 272, 416
AluI AGCT 3 cut(s) 37, 272, 416
AlwI GGATC 3 cut(s) 87, 96, 235
AoxI GGCC 2 cut(s) 26, 286
ApeKI GCWGC 1 cut(s) 272
AspLEI GCGC 1 cut(s) 174
AspS9I GGNCC 1 cut(s) 286
AsuHPI GGTGA 1 cut(s) 245
BanI GGYRCC 1 cut(s) 171
BbsI GAAGAC 2 cut(s) 113, 198
BbvI GCAGC 1 cut(s) 259
BccI CCATC 2 cut(s) 79, 96
BciT130I CCWGG 1 cut(s) 225
BclI TGATCA 1 cut(s) 76
BfoI RGCGCY 1 cut(s) 175
BisI GCNGC 1 cut(s) 273
BlsI GCNGC 1 cut(s) 274
Bme1390I CCNGG 1 cut(s) 225
BmgT120I GGNCC 1 cut(s) 286
BmiI GGNNCC 3 cut(s) 173, 287, 422
BmrFI CCNGG 1 cut(s) 225
BmsI GCATC 2 cut(s) 165, 195
BpiI GAAGAC 2 cut(s) 113, 198
BpuEI CTTGAG 2 cut(s) 312, 443
Bsa29I ATCGAT 1 cut(s) 91
BsaHI GRCGYC 2 cut(s) 45, 172
BsaJI CCNNGG 2 cut(s) 167, 289
BsaXI ACNNNNNCTCC 2 cut(s) 422, 452
Bsc4I CCNNNNNNNGG 5 cut(s) 102, 168, 230, 352, 430
Bse118I RCCGGY 1 cut(s) 174
BseBI CCWGG 1 cut(s) 225
BseCI ATCGAT 1 cut(s) 91
BseDI CCNNGG 2 cut(s) 167, 289
BseGI GGATG 2 cut(s) 154, 156
BseLI CCNNNNNNNGG 5 cut(s) 102, 168, 230, 352, 430
BseMII CTCAG 1 cut(s) 410
BseRI GAGGAG 1 cut(s) 457
BseXI GCAGC 1 cut(s) 259
BseYI CCCAGC 1 cut(s) 416
Bsh1285I CGRYCG 1 cut(s) 204
BshFI GGCC 2 cut(s) 28, 288
BshNI GGYRCC 1 cut(s) 171
BshVI ATCGAT 1 cut(s) 91
BsiEI CGRYCG 1 cut(s) 204
BsiSI CCGG 3 cut(s) 25, 69, 175
BslI CCNNNNNNNGG 5 cut(s) 102, 168, 230, 352, 430
BsnI GGCC 2 cut(s) 28, 288
Bsp143I GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
BspANI GGCC 2 cut(s) 28, 288
BspCNI CTCAG 1 cut(s) 409
BspDI ATCGAT 1 cut(s) 91
BspLI GGNNCC 3 cut(s) 173, 287, 422
BspPI GGATC 3 cut(s) 87, 96, 235
BspT107I GGYRCC 1 cut(s) 171
BsrFI RCCGGY 1 cut(s) 174
BssAI RCCGGY 1 cut(s) 174
BssECI CCNNGG 2 cut(s) 167, 289
BssMI GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
BssNI GRCGYC 2 cut(s) 45, 172
BssT1I CCWWGG 2 cut(s) 167, 289
Bst2UI CCWGG 1 cut(s) 225
Bst4CI ACNGT 2 cut(s) 197, 217
BstACI GRCGYC 2 cut(s) 45, 172
BstDEI CTNAG 1 cut(s) 396
BstF5I GGATG 2 cut(s) 154, 156
BstH2I RGCGCY 1 cut(s) 175
BstHHI GCGC 1 cut(s) 174
BstKTI GATC 8 cut(s) 18, 55, 79, 91, 95, 204, 230, 324
BstMBI GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
BstMCI CGRYCG 1 cut(s) 204
BstMWI GCNNNNNNNGC 2 cut(s) 34, 272
BstNI CCWGG 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 223
BstV1I GCAGC 1 cut(s) 259
BstV2I GAAGAC 2 cut(s) 113, 198
Bsu15I ATCGAT 1 cut(s) 91
BsuRI GGCC 2 cut(s) 28, 288
BsuTUI ATCGAT 1 cut(s) 91
BtsCI GGATG 2 cut(s) 154, 156
CfoI GCGC 1 cut(s) 174
Cfr10I RCCGGY 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 286
ClaI ATCGAT 1 cut(s) 91
CseI GACGC 1 cut(s) 53
CviAII CATG 1 cut(s) 58
CviJI RGCY 5 cut(s) 28, 37, 272, 288, 416
CviKI_1 RGCY 5 cut(s) 28, 37, 272, 288, 416
DdeI CTNAG 1 cut(s) 396
DinI GGCGCC 1 cut(s) 173
DpnI GATC 8 cut(s) 17, 54, 78, 90, 94, 203, 229, 323
DpnII GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
EaeI YGGCCR 1 cut(s) 26
Eco130I CCWWGG 2 cut(s) 167, 289
Eco32I GATATC 1 cut(s) 455
EcoRII CCWGG 1 cut(s) 223
EcoRV GATATC 1 cut(s) 455
EcoT14I CCWWGG 2 cut(s) 167, 289
EcoT22I ATGCAT 1 cut(s) 188
EgeI GGCGCC 1 cut(s) 173
EheI GGCGCC 1 cut(s) 173
ErhI CCWWGG 2 cut(s) 167, 289
FaeI CATG 1 cut(s) 61
FaiI YATR 9 cut(s) 59, 64, 184, 246, 264, 269, 450, 470, 489
FatI CATG 1 cut(s) 57
FbaI TGATCA 1 cut(s) 76
Fnu4HI GCNGC 1 cut(s) 273
FokI GGATG 2 cut(s) 143, 161
Fsp4HI GCNGC 1 cut(s) 273
GlaI GCGC 1 cut(s) 173
GluI GCNGC 1 cut(s) 273
GsaI CCCAGC 1 cut(s) 420
HaeII RGCGCY 1 cut(s) 175
HaeIII GGCC 2 cut(s) 28, 288
HapII CCGG 3 cut(s) 25, 69, 175
HgaI GACGC 1 cut(s) 53
HhaI GCGC 1 cut(s) 174
Hin1I GRCGYC 2 cut(s) 45, 172
Hin1II CATG 1 cut(s) 61
Hin6I GCGC 1 cut(s) 172
HinP1I GCGC 1 cut(s) 172
HincII GTYRAC 2 cut(s) 114, 135
HindII GTYRAC 2 cut(s) 114, 135
HinfI GANTC 2 cut(s) 5, 207
HpaII CCGG 3 cut(s) 25, 69, 175
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 2 cut(s) 114, 135
Hpy188I TCNGA 4 cut(s) 43, 101, 206, 399
Hpy8I GTNNAC 2 cut(s) 114, 135
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 2 cut(s) 197, 217
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 4 cut(s) 156, 186, 275, 364
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 272
HpyF3I CTNAG 1 cut(s) 396
HpySE526I ACGT 1 cut(s) 110
Hsp92I GRCGYC 2 cut(s) 45, 172
Hsp92II CATG 1 cut(s) 61
HspAI GCGC 1 cut(s) 172
KasI GGCGCC 1 cut(s) 171
Ksp22I TGATCA 1 cut(s) 76
Kzo9I GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
LpnPI CCDG 9 cut(s) 38, 82, 188, 210, 216, 226, 237, 343, 402
Lsp1109I GCAGC 1 cut(s) 259
LweI GCATC 2 cut(s) 165, 195
MaeII ACGT 1 cut(s) 110
MaeIII GTNAC 1 cut(s) 211
MalI GATC 8 cut(s) 17, 54, 78, 90, 94, 203, 229, 323
MboI GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
MboII GAAGA 2 cut(s) 118, 203
MluCI AATT 2 cut(s) 11, 349
Mly113I GGCGCC 1 cut(s) 172
MmeI TCCRAC 1 cut(s) 66
MnlI CCTC 5 cut(s) 107, 307, 393, 424, 435
Mph1103I ATGCAT 1 cut(s) 188
MseI TTAA 1 cut(s) 508
MspI CCGG 3 cut(s) 25, 69, 175
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
MwoI GCNNNNNNNGC 2 cut(s) 34, 272
NarI GGCGCC 1 cut(s) 172
NdeII GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
NlaIII CATG 1 cut(s) 61
NlaIV GGNNCC 3 cut(s) 173, 287, 422
NsiI ATGCAT 1 cut(s) 188
PcsI WCGNNNNNNNCGW 1 cut(s) 97
PfeI GAWTC 1 cut(s) 207
PfoI TCCNGGA 1 cut(s) 223
PkrI GCNGC 1 cut(s) 274
Ple19I CGATCG 1 cut(s) 204
PluTI GGCGCC 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 223
PspFI CCCAGC 1 cut(s) 416
PspGI CCWGG 1 cut(s) 223
PspN4I GGNNCC 3 cut(s) 173, 287, 422
PspPI GGNCC 1 cut(s) 286
PvuI CGATCG 1 cut(s) 204
SaqAI TTAA 1 cut(s) 508
SatI GCNGC 1 cut(s) 273
Sau3AI GATC 8 cut(s) 15, 52, 76, 88, 92, 201, 227, 321
Sau96I GGNCC 1 cut(s) 286
ScrFI CCNGG 1 cut(s) 225
SetI ASST 9 cut(s) 39, 113, 235, 274, 318, 362, 370, 393, 418
SfaNI GCATC 2 cut(s) 165, 195
SfoI GGCGCC 1 cut(s) 173
SmlI CTYRAG 2 cut(s) 327, 458
SmoI CTYRAG 2 cut(s) 327, 458
Sse9I AATT 2 cut(s) 11, 349
SspDI GGCGCC 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 223
StyI CCWWGG 2 cut(s) 167, 289
TaaI ACNGT 2 cut(s) 197, 217
TaiI ACGT 1 cut(s) 113
TaqI TCGA 3 cut(s) 91, 189, 200
TasI AATT 2 cut(s) 11, 349
TfiI GAWTC 1 cut(s) 207
Tru1I TTAA 1 cut(s) 508
Tru9I TTAA 1 cut(s) 508
TseI GCWGC 1 cut(s) 272
TspDTI ATGAA 1 cut(s) 130
Zsp2I ATGCAT 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.