Rmu_sc0004536.1_g000004

N-acetyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004536.1
OG0001211
Physical Location & Seq
Forward (+)
6607 .. 9160
2554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004536.1_g000004.1.cds

Sequence Viewer

Length: 417 bp
atggattcctccagaatttcacttcgtcctttcaaactctccgatgcagatgacttcctgaaatgggcaagtgatgacagagtaacacgctatctgagatggaacaccataacctctggagaagaagccttgacatatattgagaaggtttgtatttctcacccatggcgtcagtccgtatgtttggatgaccattgcataggatatgtttctgtcaaacccgaacggggtgatgattcgtgcagggcacatgttagctatgctttgtctgcagacttctgggggcaagggattgtcacattggcattgaagatggccatctctagggtcttcaaagagaatgacaatgttgagaattctattgatagctaccacgaagcctttgatgttgttgacctggtgagttcagttctctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Acetyltransf_3

Protein Analysis

138

Amino Acids

15.7

Weight (kDa)

4.96

Isoelectric Point (pI)

34.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 315
AcsI RAATTY 2 cut(s) 15, 355
AcyI GRCGYC 1 cut(s) 169
AfiI CCNNNNNNNGG 3 cut(s) 64, 227, 324
AflIII ACRYGT 1 cut(s) 250
AgsI TTSAA 3 cut(s) 34, 310, 334
AjnI CCWGG 1 cut(s) 396
AluBI AGCT 2 cut(s) 258, 369
AluI AGCT 2 cut(s) 258, 369
AoxI GGCC 1 cut(s) 315
ApoI RAATTY 2 cut(s) 15, 355
AsuHPI GGTGA 3 cut(s) 152, 242, 412
BaeGI GKGCMC 1 cut(s) 250
BalI TGGCCA 1 cut(s) 317
BbsI GAAGAC 1 cut(s) 322
BccI CCATC 3 cut(s) 93, 307, 326
BciT130I CCWGG 1 cut(s) 398
BfaI CTAG 1 cut(s) 324
BfmI CTRYAG 1 cut(s) 270
Bme1390I CCNGG 1 cut(s) 398
BmrFI CCNGG 1 cut(s) 398
BmsI GCATC 1 cut(s) 34
BpiI GAAGAC 1 cut(s) 322
BpmI CTGGAG 1 cut(s) 138
BsaBI GATNNNNATC 1 cut(s) 317
BsaHI GRCGYC 1 cut(s) 169
BsaJI CCNNGG 1 cut(s) 164
Bsc4I CCNNNNNNNGG 3 cut(s) 64, 227, 324
Bse3DI GCAATG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 317
BseBI CCWGG 1 cut(s) 398
BseDI CCNNGG 1 cut(s) 164
BseGI GGATG 1 cut(s) 193
BseJI GATNNNNATC 1 cut(s) 317
BseLI CCNNNNNNNGG 3 cut(s) 64, 227, 324
BseMI GCAATG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 86
BseSI GKGCMC 1 cut(s) 250
BsgI GTGCAG 1 cut(s) 262
BshFI GGCC 1 cut(s) 317
BslI CCNNNNNNNGG 3 cut(s) 64, 227, 324
BsnI GGCC 1 cut(s) 317
Bsp1286I GDGCHC 1 cut(s) 250
Bsp19I CCATGG 1 cut(s) 164
BspANI GGCC 1 cut(s) 317
BspCNI CTCAG 1 cut(s) 87
BspMAI CTGCAG 1 cut(s) 274
BsrDI GCAATG 1 cut(s) 193
BssECI CCNNGG 1 cut(s) 164
BssNI GRCGYC 1 cut(s) 169
BssT1I CCWWGG 1 cut(s) 164
Bst2UI CCWGG 1 cut(s) 398
BstACI GRCGYC 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 95
BstDSI CCRYGG 1 cut(s) 164
BstF5I GGATG 1 cut(s) 193
BstMWI GCNNNNNNNGC 1 cut(s) 269
BstNI CCWGG 1 cut(s) 398
BstNSI RCATGY 1 cut(s) 254
BstSCI CCNGG 1 cut(s) 396
BstSFI CTRYAG 1 cut(s) 270
BstSLI GKGCMC 1 cut(s) 250
BstV2I GAAGAC 1 cut(s) 322
BsuRI GGCC 1 cut(s) 317
BtgI CCRYGG 1 cut(s) 164
BtsCI GGATG 1 cut(s) 193
CseI GACGC 1 cut(s) 158
CsiI ACCWGGT 1 cut(s) 396
CviAII CATG 2 cut(s) 165, 251
CviJI RGCY 5 cut(s) 128, 258, 317, 369, 380
CviKI_1 RGCY 5 cut(s) 128, 258, 317, 369, 380
DdeI CTNAG 1 cut(s) 95
EaeI YGGCCR 1 cut(s) 315
Eco130I CCWWGG 1 cut(s) 164
EcoRI GAATTC 1 cut(s) 355
EcoRII CCWGG 1 cut(s) 396
EcoT14I CCWWGG 1 cut(s) 164
ErhI CCWWGG 1 cut(s) 164
FaeI CATG 2 cut(s) 168, 254
FaiI YATR 9 cut(s) 110, 136, 138, 166, 181, 200, 207, 252, 261
FatI CATG 2 cut(s) 164, 250
FokI GGATG 1 cut(s) 200
FspBI CTAG 1 cut(s) 324
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 317
HgaI GACGC 1 cut(s) 158
Hin1I GRCGYC 1 cut(s) 169
Hin1II CATG 2 cut(s) 168, 254
HincII GTYRAC 1 cut(s) 394
HindII GTYRAC 1 cut(s) 394
HinfI GANTC 2 cut(s) 5, 236
HphI GGTGA 3 cut(s) 152, 242, 412
Hpy166II GTNNAC 1 cut(s) 394
Hpy188I TCNGA 3 cut(s) 43, 96, 416
Hpy188III TCNNGA 3 cut(s) 12, 58, 117
Hpy8I GTNNAC 1 cut(s) 394
HpyAV CCTTC 1 cut(s) 139
HpyCH4V TGCA 4 cut(s) 47, 198, 243, 272
HpyF10VI GCNNNNNNNGC 1 cut(s) 269
HpyF3I CTNAG 1 cut(s) 95
Hsp92I GRCGYC 1 cut(s) 169
Hsp92II CATG 2 cut(s) 168, 254
LpnPI CCDG 7 cut(s) 25, 71, 102, 229, 265, 383, 410
LweI GCATC 1 cut(s) 34
MabI ACCWGGT 1 cut(s) 396
MaeI CTAG 1 cut(s) 324
MaeIII GTNAC 2 cut(s) 82, 295
MboII GAAGA 3 cut(s) 134, 322, 322
MhlI GDGCHC 1 cut(s) 250
MlsI TGGCCA 1 cut(s) 317
MluCI AATT 2 cut(s) 15, 355
MluNI TGGCCA 1 cut(s) 317
MnlI CCTC 2 cut(s) 19, 124
Mox20I TGGCCA 1 cut(s) 317
MscI TGGCCA 1 cut(s) 317
Msp20I TGGCCA 1 cut(s) 317
MspR9I CCNGG 1 cut(s) 398
MvaI CCWGG 1 cut(s) 398
MwoI GCNNNNNNNGC 1 cut(s) 269
NcoI CCATGG 1 cut(s) 164
NlaIII CATG 2 cut(s) 168, 254
NmuCI GTSAC 1 cut(s) 295
NspI RCATGY 1 cut(s) 254
PciI ACATGT 1 cut(s) 250
PfeI GAWTC 2 cut(s) 5, 236
PscI ACATGT 1 cut(s) 250
Psp6I CCWGG 1 cut(s) 396
PspGI CCWGG 1 cut(s) 396
PstI CTGCAG 1 cut(s) 274
ScrFI CCNGG 1 cut(s) 398
SduI GDGCHC 1 cut(s) 250
SetI ASST 5 cut(s) 116, 150, 260, 371, 399
SexAI ACCWGGT 1 cut(s) 396
SfaNI GCATC 1 cut(s) 34
SfcI CTRYAG 1 cut(s) 270
Sse9I AATT 2 cut(s) 15, 355
SspMI CTAG 1 cut(s) 324
StyD4I CCNGG 1 cut(s) 396
StyI CCWWGG 1 cut(s) 164
TasI AATT 2 cut(s) 15, 355
TfiI GAWTC 2 cut(s) 5, 236
TseFI GTSAC 1 cut(s) 295
Tsp45I GTSAC 1 cut(s) 295
TspGWI ACGGA 1 cut(s) 166
XapI RAATTY 2 cut(s) 15, 355
XceI RCATGY 1 cut(s) 254
XspI CTAG 1 cut(s) 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.