pycom09g14230

Protein of unknown function (DUF642)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
Physical Location & Seq
Forward (+)
13679056 .. 13679298
243 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 243 bp
ATGGTCAATTTTGCCCACAAAGCTGGTGGGTGCCTAAAACTTCCCGACATCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTTCTCCTGGGATGATGCGCTACAAAGCCCAAGTGGTGGCATCGGCCATCGCTTTGCCGATTTGCCGGAAAATTGAAAAGGGTGGCTGGAGCACCATTGATTTTCGTCAACTTTCGTGGCCTCAAACCGCCACATACCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

8.75

Weight (kDa)

9.69

Isoelectric Point (pI)

37.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 30
AccB7I CCANNNNNTGG 1 cut(s) 133
AccI GTMKAC 1 cut(s) 62
AciI CCGC 1 cut(s) 225
AcoI YGGCCR 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 133
AgsI TTSAA 1 cut(s) 173
AjnI CCWGG 1 cut(s) 103
AluBI AGCT 1 cut(s) 23
AluI AGCT 1 cut(s) 23
Alw21I GWGCWC 1 cut(s) 191
AoxI GGCC 2 cut(s) 141, 215
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BanI GGYRCC 1 cut(s) 30
Bbv12I GWGCWC 1 cut(s) 191
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 105
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmiI GGNNCC 1 cut(s) 32
BmrFI CCNGG 1 cut(s) 105
BmsI GCATC 2 cut(s) 102, 146
BpmI CTGGAG 1 cut(s) 205
Bsa29I ATCGAT 1 cut(s) 51
BsaJI CCNNGG 2 cut(s) 104, 235
Bsc4I CCNNNNNNNGG 1 cut(s) 133
BseBI CCWGG 1 cut(s) 105
BseCI ATCGAT 1 cut(s) 51
BseDI CCNNGG 2 cut(s) 104, 235
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 133
BshFI GGCC 2 cut(s) 143, 217
BshNI GGYRCC 1 cut(s) 30
BshVI ATCGAT 1 cut(s) 51
BsiHKAI GWGCWC 1 cut(s) 191
BsiSI CCGG 1 cut(s) 163
BslI CCNNNNNNNGG 1 cut(s) 133
BsnI GGCC 2 cut(s) 143, 217
Bsp1286I GDGCHC 1 cut(s) 191
Bsp19I CCATGG 1 cut(s) 235
BspACI CCGC 1 cut(s) 225
BspANI GGCC 2 cut(s) 143, 217
BspDI ATCGAT 1 cut(s) 51
BspLI GGNNCC 1 cut(s) 32
BspT107I GGYRCC 1 cut(s) 30
BssECI CCNNGG 2 cut(s) 104, 235
BssT1I CCWWGG 1 cut(s) 235
Bst2UI CCWGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 67
BstDSI CCRYGG 1 cut(s) 235
BstF5I GGATG 1 cut(s) 114
BstHHI GCGC 1 cut(s) 117
BstMWI GCNNNNNNNGC 1 cut(s) 20
BstNI CCWGG 1 cut(s) 105
BstSCI CCNGG 1 cut(s) 103
BstXI CCANNNNNNTGG 1 cut(s) 23
Bsu15I ATCGAT 1 cut(s) 51
BsuRI GGCC 2 cut(s) 143, 217
BsuTUI ATCGAT 1 cut(s) 51
BtgI CCRYGG 1 cut(s) 235
BtgZI GCGATG 1 cut(s) 130
BtsCI GGATG 1 cut(s) 114
CfoI GCGC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 70
ClaI ATCGAT 1 cut(s) 51
CspCI CAANNNNNGTGG 4 cut(s) 7, 42, 194, 229
CviAII CATG 1 cut(s) 236
CviJI RGCY 5 cut(s) 23, 125, 143, 183, 217
CviKI_1 RGCY 5 cut(s) 23, 125, 143, 183, 217
EaeI YGGCCR 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 235
Eco47I GGWCC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 103
EcoT14I CCWWGG 1 cut(s) 235
ErhI CCWWGG 1 cut(s) 235
FaeI CATG 1 cut(s) 239
FaiI YATR 2 cut(s) 232, 237
FatI CATG 1 cut(s) 235
FblI GTMKAC 1 cut(s) 62
FokI GGATG 1 cut(s) 121
GlaI GCGC 1 cut(s) 116
GsuI CTGGAG 1 cut(s) 205
HaeIII GGCC 2 cut(s) 143, 217
HapII CCGG 1 cut(s) 163
HhaI GCGC 1 cut(s) 117
Hin1II CATG 1 cut(s) 239
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HincII GTYRAC 1 cut(s) 206
HindII GTYRAC 1 cut(s) 206
HinfI GANTC 1 cut(s) 53
HpaII CCGG 1 cut(s) 163
Hpy166II GTNNAC 2 cut(s) 63, 206
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 2 cut(s) 63, 206
Hpy99I CGWCG 1 cut(s) 61
HpyCH4III ACNGT 1 cut(s) 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 20
Hsp92II CATG 1 cut(s) 239
HspAI GCGC 1 cut(s) 115
LmnI GCTCC 1 cut(s) 186
LpnPI CCDG 5 cut(s) 9, 90, 117, 169, 176
LweI GCATC 2 cut(s) 102, 146
MhlI GDGCHC 1 cut(s) 191
MluCI AATT 2 cut(s) 7, 168
MmeI TCCRAC 1 cut(s) 97
MnlI CCTC 1 cut(s) 228
MseI TTAA 1 cut(s) 241
MspI CCGG 1 cut(s) 163
MspR9I CCNGG 1 cut(s) 105
MvaI CCWGG 1 cut(s) 105
MwoI GCNNNNNNNGC 1 cut(s) 20
NcoI CCATGG 1 cut(s) 235
NlaIII CATG 1 cut(s) 239
NlaIV GGNNCC 1 cut(s) 32
PfeI GAWTC 1 cut(s) 53
PflMI CCANNNNNTGG 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 103
PspGI CCWGG 1 cut(s) 103
PspN4I GGNNCC 1 cut(s) 32
PspPI GGNCC 1 cut(s) 70
SaqAI TTAA 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 105
SduI GDGCHC 1 cut(s) 191
SetI ASST 2 cut(s) 25, 88
SfaNI GCATC 2 cut(s) 102, 146
SinI GGWCC 1 cut(s) 70
Sse9I AATT 2 cut(s) 7, 168
SsiI CCGC 1 cut(s) 225
StyD4I CCNGG 1 cut(s) 103
StyI CCWWGG 1 cut(s) 235
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 1 cut(s) 51
TasI AATT 2 cut(s) 7, 168
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 241
Tru9I TTAA 1 cut(s) 241
Van91I CCANNNNNTGG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 70
XcmI CCANNNNNNNNNTGG 1 cut(s) 23
XmiI GTMKAC 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.