pycom11g20560

Protein of unknown function (DUF642)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
23611763 .. 23612068
306 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 306 bp
ATGAATATCTCAGTGAGTGGAGCAACTTTCATACCTGTCACGAAGTCCAAAAGTGGACGGAAGATGGTCAATTTTTCCCACAAAGCTGGCGGGTGCCTAAAACTTCCCGACGTCGATTCGTCGTCTACGGTGGTCCAACGGGGTCAAGGTTGGTTGGGTTTTGCTCCTGGGATGATGGGCTACAAAGCCCAAGTGGTGGCATCGGCCATCGCTTTGCCGATTTGCCGAAAAATCGAAAAGGGTGGCCGGAGCACTATTGATTTTCGTCAACTTTCGTGGCCTCAAACCGCCACATCCCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

10.73

Weight (kDa)

10.3

Isoelectric Point (pI)

40.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 114
AccB1I GGYRCC 1 cut(s) 93
AccB7I CCANNNNNTGG 1 cut(s) 196
AccI GTMKAC 1 cut(s) 125
AciI CCGC 2 cut(s) 90, 288
AcoI YGGCCR 2 cut(s) 204, 244
AcyI GRCGYC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 196
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 1 cut(s) 86
AluI AGCT 1 cut(s) 86
Alw21I GWGCWC 1 cut(s) 254
AoxI GGCC 3 cut(s) 204, 244, 278
AspS9I GGNCC 1 cut(s) 133
AvaII GGWCC 1 cut(s) 133
BanI GGYRCC 1 cut(s) 93
Bbv12I GWGCWC 1 cut(s) 254
BccI CCATC 3 cut(s) 58, 169, 215
BciT130I CCWGG 1 cut(s) 168
Bme1390I CCNGG 1 cut(s) 168
Bme18I GGWCC 1 cut(s) 133
BmgT120I GGNCC 1 cut(s) 133
BmiI GGNNCC 1 cut(s) 95
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 1 cut(s) 209
BsaHI GRCGYC 1 cut(s) 111
BsaJI CCNNGG 2 cut(s) 167, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 2 cut(s) 167, 298
BseGI GGATG 2 cut(s) 177, 293
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 24
BshFI GGCC 3 cut(s) 206, 246, 280
BshNI GGYRCC 1 cut(s) 93
BsiHKAI GWGCWC 1 cut(s) 254
BsiSI CCGG 1 cut(s) 247
BslI CCNNNNNNNGG 1 cut(s) 196
BsnI GGCC 3 cut(s) 206, 246, 280
Bsp1286I GDGCHC 1 cut(s) 254
Bsp19I CCATGG 1 cut(s) 298
BspACI CCGC 2 cut(s) 90, 288
BspANI GGCC 3 cut(s) 206, 246, 280
BspCNI CTCAG 1 cut(s) 23
BspLI GGNNCC 1 cut(s) 95
BspT107I GGYRCC 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 167, 298
BssNI GRCGYC 1 cut(s) 111
BssT1I CCWWGG 1 cut(s) 298
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 130
BstACI GRCGYC 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 298
BstF5I GGATG 2 cut(s) 177, 293
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstXI CCANNNNNNTGG 1 cut(s) 86
BsuRI GGCC 3 cut(s) 206, 246, 280
BtgI CCRYGG 1 cut(s) 298
BtgZI GCGATG 1 cut(s) 193
BtsCI GGATG 2 cut(s) 177, 293
BtsIMutI CAGTG 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 88
Cfr13I GGNCC 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 257, 292
CviAII CATG 1 cut(s) 299
CviJI RGCY 6 cut(s) 86, 180, 188, 206, 246, 280
CviKI_1 RGCY 6 cut(s) 86, 180, 188, 206, 246, 280
DdeI CTNAG 1 cut(s) 10
EaeI YGGCCR 2 cut(s) 204, 244
Eco130I CCWWGG 1 cut(s) 298
Eco47I GGWCC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 298
ErhI CCWWGG 1 cut(s) 298
FaeI CATG 1 cut(s) 302
FaiI YATR 2 cut(s) 32, 300
FatI CATG 1 cut(s) 298
FauI CCCGC 1 cut(s) 83
FblI GTMKAC 1 cut(s) 125
FokI GGATG 2 cut(s) 184, 280
HaeIII GGCC 3 cut(s) 206, 246, 280
HapII CCGG 1 cut(s) 247
Hin1I GRCGYC 1 cut(s) 111
Hin1II CATG 1 cut(s) 302
HincII GTYRAC 1 cut(s) 269
HindII GTYRAC 1 cut(s) 269
HinfI GANTC 1 cut(s) 116
HpaII CCGG 1 cut(s) 247
Hpy166II GTNNAC 3 cut(s) 56, 126, 269
Hpy188III TCNNGA 2 cut(s) 40, 107
Hpy8I GTNNAC 3 cut(s) 56, 126, 269
Hpy99I CGWCG 3 cut(s) 113, 116, 124
HpyCH4III ACNGT 1 cut(s) 130
HpyCH4IV ACGT 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 10
HpySE526I ACGT 1 cut(s) 111
Hsp92I GRCGYC 1 cut(s) 111
Hsp92II CATG 1 cut(s) 302
LmnI GCTCC 3 cut(s) 20, 169, 249
LpnPI CCDG 5 cut(s) 48, 72, 153, 180, 260
LweI GCATC 1 cut(s) 209
MaeII ACGT 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 37
MboII GAAGA 1 cut(s) 73
MhlI GDGCHC 1 cut(s) 254
MluCI AATT 1 cut(s) 70
MmeI TCCRAC 1 cut(s) 160
MnlI CCTC 1 cut(s) 291
MseI TTAA 1 cut(s) 304
MspI CCGG 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
NcoI CCATGG 1 cut(s) 298
NlaIII CATG 1 cut(s) 302
NlaIV GGNNCC 1 cut(s) 95
NmuCI GTSAC 1 cut(s) 37
PfeI GAWTC 1 cut(s) 116
PflMI CCANNNNNTGG 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
PspN4I GGNNCC 1 cut(s) 95
PspPI GGNCC 1 cut(s) 133
SaqAI TTAA 1 cut(s) 304
Sau96I GGNCC 1 cut(s) 133
ScrFI CCNGG 1 cut(s) 168
SduI GDGCHC 1 cut(s) 254
SetI ASST 4 cut(s) 37, 88, 114, 151
SfaNI GCATC 1 cut(s) 209
SinI GGWCC 1 cut(s) 133
Sse9I AATT 1 cut(s) 70
SsiI CCGC 2 cut(s) 90, 288
StyD4I CCNGG 1 cut(s) 166
StyI CCWWGG 1 cut(s) 298
TaaI ACNGT 1 cut(s) 130
TaiI ACGT 1 cut(s) 114
TaqI TCGA 2 cut(s) 114, 234
TasI AATT 1 cut(s) 70
TfiI GAWTC 1 cut(s) 116
Tru1I TTAA 1 cut(s) 304
Tru9I TTAA 1 cut(s) 304
TscAI CASTG 1 cut(s) 18
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 17, 19
TspGWI ACGGA 1 cut(s) 73
TspRI CASTG 1 cut(s) 18
Van91I CCANNNNNTGG 1 cut(s) 196
VpaK11BI GGWCC 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 125
ZraI GACGTC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.