Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr12

Orthogroup ID

OG0002704

Physical Location & Seq

Genomic Coordinates Forward (+)

16943210 .. 16944181

Gene Structure 972 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12g14380.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 498 bp

ATGGAGTCACTCTTTGATTCTGGCAAGGCCAGGGCCATTGGAGTCTGCAATTTCTCTTCAAAGAAGCTCGGAGATCTGTTGGAGGTGGCACGAATACCTCCTGCAGTTAATCAAGTGGAATTGCACCCTCACTGGCAGCAACTAAAGCTGCACGCTTTCTGTAAATCCAAGGGAATTCACTTAACTGGATTTGCACCATTGGCGAGGAACAAGGTCCTTACGAATCCTATTGTGAATTTGGTAGCAGAAAAATTGGGCAAGACTACTGCCCAAGTGACTCTTCGGTGGGGGCTGCAAATGGGCCACAGTCTAGTGCCTAAAAGCACAAATCCAGAAAGGATACAGGAAAATTTTGATATTTTCGATTGGTCTATACCTGAAGACTTGTTTGCCAAGTTTTCTGAAACTAATCAGGAGAGGCTTATTAAAGGTACTGGTTTCGTGCATGAGACTCTAGGTGCATACAGGACCGTGGAAGAACTATGGGACGGCGAGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0005829 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

ko00010 ko00040 ko00561 ko00930 ko01100 ko01110 ko01120 ko01130 ko01220 map00010 map00040 map00561 map00930 map01100 map01110 map01120 map01130 map01220

Pfam Domains

Protein Families

Aldo_ket_red

Protein Analysis

166

Amino Acids

18.54

Weight (kDa)

7.02

Isoelectric Point (pI)

22.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002704)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g13021 FvH4_6g13030
malus_domestica	MD00G1141700.v1.1 MD12G1149800.v1.1 MD12G1150000.v1.1
prunus_persica	Prupe.6G261600_v2.0.a1 Prupe.6G261700_v2.0.a1
pyrus_communis	pycom04g12310 pycom12g14360 pycom12g14370 pycom12g14380
rosa_chinensis	RchiOBHm_Chr3g0465241 RchiOBHm_Chr3g0465281 RchiOBHm_Chr3g0465291 RchiOBHm_Chr3g0465301
rosa_multiflora	Rmu_co8361281.1_g000001 Rmu_sc0005190.1_g000002 Rmu_sc0005190.1_g000003 Rmu_sc0005190.1_g000004 Rmu_sc0005190.1_g000005 Rmu_sc0015811.1_g000003 Rmu_sc0029050.1_g000001 Rmu_sc0029051.1_g000001
rosa_roxburghii	Rroxscaffold_6G00415140 Rroxscaffold_6G00415150 Rroxscaffold_6G00415180
rosa_rugosa	Rorug03G0076200 Rorug03G0076200
rosa_samantha	Rh3BG140300 Rh3BG140600 Rh3BG140700 Rh3BG140800 Rh3DG141700 Rh3DG141800 Rh3DG141900
rosa_wichuraiana	Rw3G011480 Rw3G011500 Rw3G011510 Rw3G011520

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	174, 235, 349
AcuI	CTGAAG	1 cut(s)	399
AfaI	GTAC	1 cut(s)	433
AgsI	TTSAA	1 cut(s)	60
AjnI	CCWGG	1 cut(s)	29
AjuI	GAANNNNNNNTTGG	2 cut(s)	264, 296
AluBI	AGCT	2 cut(s)	67, 148
AluI	AGCT	2 cut(s)	67, 148
Alw26I	GTCTC	1 cut(s)	443
AoxI	GGCC	3 cut(s)	27, 33, 301
ApeKI	GCWGC	3 cut(s)	136, 148, 292
ApoI	RAATTY	3 cut(s)	174, 235, 349
AspS9I	GGNCC	4 cut(s)	33, 214, 301, 468
AvaII	GGWCC	2 cut(s)	214, 468
BbsI	GAAGAC	1 cut(s)	387
BbvI	GCAGC	3 cut(s)	135, 148, 279
BciT130I	CCWGG	1 cut(s)	31
BciVI	GTATCC	1 cut(s)	333
BcoDI	GTCTC	1 cut(s)	443
BfaI	CTAG	2 cut(s)	311, 455
BfmI	CTRYAG	1 cut(s)	102
BfuI	GTATCC	1 cut(s)	333
BglII	AGATCT	1 cut(s)	73
BisI	GCNGC	3 cut(s)	137, 149, 293
BlsI	GCNGC	3 cut(s)	138, 150, 294
Bme1390I	CCNGG	1 cut(s)	31
Bme18I	GGWCC	2 cut(s)	214, 468
BmgT120I	GGNCC	4 cut(s)	33, 214, 301, 468
BmrFI	CCNGG	1 cut(s)	31
BpiI	GAAGAC	1 cut(s)	387
BsaJI	CCNNGG	3 cut(s)	30, 168, 471
Bse1I	ACTGG	3 cut(s)	137, 190, 439
BseBI	CCWGG	1 cut(s)	31
BseDI	CCNNGG	3 cut(s)	30, 168, 471
BseNI	ACTGG	3 cut(s)	137, 190, 439
BseXI	GCAGC	3 cut(s)	135, 148, 279
BsgI	GTGCAG	1 cut(s)	134
BshFI	GGCC	3 cut(s)	29, 35, 303
BsmAI	GTCTC	1 cut(s)	443
BsnI	GGCC	3 cut(s)	29, 35, 303
Bsp143I	GATC	1 cut(s)	73
BspANI	GGCC	3 cut(s)	29, 35, 303
BspMAI	CTGCAG	1 cut(s)	106
BsrI	ACTGG	3 cut(s)	137, 190, 439
BssECI	CCNNGG	3 cut(s)	30, 168, 471
BssMI	GATC	1 cut(s)	73
BssT1I	CCWWGG	1 cut(s)	168
Bst2UI	CCWGG	1 cut(s)	31
Bst4CI	ACNGT	2 cut(s)	308, 472
Bst6I	CTCTTC	2 cut(s)	61, 285
BstC8I	GCNNGC	1 cut(s)	153
BstDSI	CCRYGG	1 cut(s)	471
BstKTI	GATC	1 cut(s)	76
BstMAI	GTCTC	1 cut(s)	443
BstMBI	GATC	1 cut(s)	73
BstMWI	GCNNNNNNNGC	2 cut(s)	145, 200
BstNI	CCWGG	1 cut(s)	31
BstSCI	CCNGG	1 cut(s)	29
BstSFI	CTRYAG	1 cut(s)	102
BstV1I	GCAGC	3 cut(s)	135, 148, 279
BstV2I	GAAGAC	1 cut(s)	387
BstX2I	RGATCY	1 cut(s)	73
BstYI	RGATCY	1 cut(s)	73
BsuI	GTATCC	1 cut(s)	333
BsuRI	GGCC	3 cut(s)	29, 35, 303
BtgI	CCRYGG	1 cut(s)	471
BtsIMutI	CAGTG	1 cut(s)	130
Cac8I	GCNNGC	1 cut(s)	153
Cfr13I	GGNCC	4 cut(s)	33, 214, 301, 468
Csp6I	GTAC	1 cut(s)	432
CviAII	CATG	1 cut(s)	446
CviJI	RGCY	7 cut(s)	29, 35, 67, 148, 292, 303, 421
CviKI_1	RGCY	7 cut(s)	29, 35, 67, 148, 292, 303, 421
CviQI	GTAC	1 cut(s)	432
DpnI	GATC	1 cut(s)	75
DpnII	GATC	1 cut(s)	73
Eam1104I	CTCTTC	2 cut(s)	61, 285
EarI	CTCTTC	2 cut(s)	61, 285
Eco130I	CCWWGG	1 cut(s)	168
Eco47I	GGWCC	2 cut(s)	214, 468
Eco57I	CTGAAG	1 cut(s)	399
EcoO109I	RGGNCCY	1 cut(s)	214
EcoRI	GAATTC	1 cut(s)	174
EcoRII	CCWGG	1 cut(s)	29
EcoT14I	CCWWGG	1 cut(s)	168
ErhI	CCWWGG	1 cut(s)	168
FaeI	CATG	1 cut(s)	449
FaiI	YATR	4 cut(s)	374, 447, 463, 484
FalI	AAGNNNNNCTT	2 cut(s)	264, 296
FatI	CATG	1 cut(s)	445
Fnu4HI	GCNGC	3 cut(s)	137, 149, 293
Fsp4HI	GCNGC	3 cut(s)	137, 149, 293
FspBI	CTAG	2 cut(s)	311, 455
GluI	GCNGC	3 cut(s)	137, 149, 293
HaeIII	GGCC	3 cut(s)	29, 35, 303
Hin1II	CATG	1 cut(s)	449
HinfI	GANTC	6 cut(s)	5, 17, 42, 223, 277, 451
Hpy188I	TCNGA	2 cut(s)	71, 403
Hpy188III	TCNNGA	2 cut(s)	332, 413
HpyCH4III	ACNGT	2 cut(s)	308, 472
HpyCH4V	TGCA	8 cut(s)	48, 104, 124, 151, 194, 295, 445, 461
HpyF10VI	GCNNNNNNNGC	2 cut(s)	145, 200
Hsp92II	CATG	1 cut(s)	449
Kzo9I	GATC	1 cut(s)	73
Lsp1109I	GCAGC	3 cut(s)	135, 148, 279
MaeI	CTAG	2 cut(s)	311, 455
MaeIII	GTNAC	2 cut(s)	6, 274
MalI	GATC	1 cut(s)	75
MboI	GATC	1 cut(s)	73
MboII	GAAGA	4 cut(s)	48, 272, 392, 488
MflI	RGATCY	1 cut(s)	73
MluCI	AATT	6 cut(s)	49, 119, 174, 235, 251, 349
MlyI	GAGTC	4 cut(s)	14, 51, 271, 445
MmeI	TCCRAC	1 cut(s)	60
MnlI	CCTC	5 cut(s)	76, 108, 138, 198, 411
MseI	TTAA	3 cut(s)	108, 182, 426
MspR9I	CCNGG	1 cut(s)	31
MvaI	CCWGG	1 cut(s)	31
MwoI	GCNNNNNNNGC	2 cut(s)	145, 200
NdeII	GATC	1 cut(s)	73
NlaIII	CATG	1 cut(s)	449
NmuCI	GTSAC	2 cut(s)	6, 274
PfeI	GAWTC	2 cut(s)	17, 223
PkrI	GCNGC	3 cut(s)	138, 150, 294
PleI	GAGTC	4 cut(s)	13, 50, 271, 445
PpsI	GAGTC	4 cut(s)	13, 50, 271, 445
PpuMI	RGGWCCY	1 cut(s)	214
Psp5II	RGGWCCY	1 cut(s)	214
Psp6I	CCWGG	1 cut(s)	29
PspGI	CCWGG	1 cut(s)	29
PspPI	GGNCC	4 cut(s)	33, 214, 301, 468
PspPPI	RGGWCCY	1 cut(s)	214
PstI	CTGCAG	1 cut(s)	106
PsuI	RGATCY	1 cut(s)	73
RsaI	GTAC	1 cut(s)	433
RsaNI	GTAC	1 cut(s)	432
SaqAI	TTAA	3 cut(s)	108, 182, 426
SatI	GCNGC	3 cut(s)	137, 149, 293
Sau3AI	GATC	1 cut(s)	73
Sau96I	GGNCC	4 cut(s)	33, 214, 301, 468
SchI	GAGTC	4 cut(s)	14, 51, 271, 445
ScrFI	CCNGG	1 cut(s)	31
SetI	ASST	8 cut(s)	69, 87, 100, 150, 216, 379, 433, 460
SfcI	CTRYAG	1 cut(s)	102
SinI	GGWCC	2 cut(s)	214, 468
Sse9I	AATT	6 cut(s)	49, 119, 174, 235, 251, 349
SspMI	CTAG	2 cut(s)	311, 455
StyD4I	CCNGG	1 cut(s)	29
StyI	CCWWGG	1 cut(s)	168
TaaI	ACNGT	2 cut(s)	308, 472
TaqI	TCGA	1 cut(s)	363
TasI	AATT	6 cut(s)	49, 119, 174, 235, 251, 349
TfiI	GAWTC	2 cut(s)	17, 223
Tru1I	TTAA	3 cut(s)	108, 182, 426
Tru9I	TTAA	3 cut(s)	108, 182, 426
TscAI	CASTG	1 cut(s)	137
TseFI	GTSAC	2 cut(s)	6, 274
TseI	GCWGC	3 cut(s)	136, 148, 292
Tsp45I	GTSAC	2 cut(s)	6, 274
TspRI	CASTG	1 cut(s)	137
VpaK11BI	GGWCC	2 cut(s)	214, 468
XapI	RAATTY	3 cut(s)	174, 235, 349
XspI	CTAG	2 cut(s)	311, 455

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.