Rmu_co8361281.1_g000001

Aldo-keto reductase family 4 member

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8361281.1
Physical Location & Seq
Forward (+)
1 .. 795
795 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8361281.1_g000001.1.cds

Sequence Viewer

Length: 312 bp
ggatatgcaccattgggaaggcaaaaggtgcttgaacattctattgtgaatatggtggcagaaaaattgggcaagactcctgcacaagtagttcttcggtgggggatgcaaatgggtcacagtgtagtgcctaaaagcacaaatcagatgaggattcaggaaaattttaatatttttgattggtctatacctgataacttgtttgccaagttttctgaaattgagcaggagaggctgcttaaaggtactgcattcgtccacaagactcacggtttttacaagaccattgaggaactctgggatggagagtag

Protein Analysis

103

Amino Acids

11.87

Weight (kDa)

7.11

Isoelectric Point (pI)

44.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 163
AfaI GTAC 1 cut(s) 247
AgsI TTSAA 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 235
ApoI RAATTY 1 cut(s) 163
BbvI GCAGC 1 cut(s) 222
BccI CCATC 1 cut(s) 296
BisI GCNGC 1 cut(s) 236
BlsI GCNGC 1 cut(s) 237
BmsI GCATC 1 cut(s) 96
BseGI GGATG 2 cut(s) 111, 307
BseXI GCAGC 1 cut(s) 222
BsgI GTGCAG 1 cut(s) 66
BsmI GAATGC 1 cut(s) 251
Bst4CI ACNGT 2 cut(s) 122, 272
BstAPI GCANNNNNTGC 1 cut(s) 28
BstF5I GGATG 2 cut(s) 111, 307
BstMWI GCNNNNNNNGC 2 cut(s) 28, 232
BstV1I GCAGC 1 cut(s) 222
BtsCI GGATG 2 cut(s) 111, 307
BtsIMutI CAGTG 1 cut(s) 127
Csp6I GTAC 1 cut(s) 246
CviJI RGCY 1 cut(s) 235
CviKI_1 RGCY 1 cut(s) 235
CviQI GTAC 1 cut(s) 246
FaiI YATR 3 cut(s) 6, 53, 188
FalI AAGNNNNNCTT 2 cut(s) 78, 110
Fnu4HI GCNGC 1 cut(s) 236
FokI GGATG 1 cut(s) 118
Fsp4HI GCNGC 1 cut(s) 236
GluI GCNGC 1 cut(s) 236
HinfI GANTC 3 cut(s) 76, 154, 265
Hpy166II GTNNAC 1 cut(s) 259
Hpy188I TCNGA 2 cut(s) 147, 217
Hpy188III TCNNGA 1 cut(s) 158
Hpy8I GTNNAC 1 cut(s) 259
HpyAV CCTTC 1 cut(s) 12
HpyCH4III ACNGT 2 cut(s) 122, 272
HpyCH4V TGCA 4 cut(s) 8, 83, 109, 251
HpyF10VI GCNNNNNNNGC 2 cut(s) 28, 232
LpnPI CCDG 5 cut(s) 93, 143, 204, 212, 283
Lsp1109I GCAGC 1 cut(s) 222
LweI GCATC 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 116
MboII GAAGA 1 cut(s) 86
MluCI AATT 3 cut(s) 65, 163, 219
MlyI GAGTC 2 cut(s) 70, 259
MnlI CCTC 3 cut(s) 144, 225, 283
MseI TTAA 2 cut(s) 168, 240
Mva1269I GAATGC 1 cut(s) 251
MwoI GCNNNNNNNGC 2 cut(s) 28, 232
NmuCI GTSAC 1 cut(s) 116
PctI GAATGC 1 cut(s) 251
PfeI GAWTC 1 cut(s) 154
PkrI GCNGC 1 cut(s) 237
PleI GAGTC 2 cut(s) 70, 259
PpsI GAGTC 2 cut(s) 70, 259
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
SaqAI TTAA 2 cut(s) 168, 240
SatI GCNGC 1 cut(s) 236
SchI GAGTC 2 cut(s) 70, 259
SetI ASST 3 cut(s) 30, 193, 247
SfaNI GCATC 1 cut(s) 96
Sse9I AATT 3 cut(s) 65, 163, 219
SspI AATATT 1 cut(s) 172
TaaI ACNGT 2 cut(s) 122, 272
TasI AATT 3 cut(s) 65, 163, 219
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 2 cut(s) 168, 240
Tru9I TTAA 2 cut(s) 168, 240
TscAI CASTG 1 cut(s) 127
TseFI GTSAC 1 cut(s) 116
TseI GCWGC 1 cut(s) 235
Tsp45I GTSAC 1 cut(s) 116
TspRI CASTG 1 cut(s) 127
XapI RAATTY 1 cut(s) 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.