pycom16g11270

Anaphase-promoting complex subunit 11 RING-H2 finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0002004
Physical Location & Seq
Reverse (-)
7809769 .. 7810473
705 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGACTCATTTGCAAGAAGATATGCAACAACTGAGAAGAGGCAGTTCTGGTACTGAATCCCTGGGTTTTGGAAAGAAATGGAATGGAGATGATACTGAAGAAGATTGTAAGTTTGGCCAATTGGAGACCTCGGAAAAGGCTTTGGCAACAAAACTTGCATATGGACTAACTTACGTGCAACCATCTTCTGAAGATGAAGATGTCTGCCCTACATGTCTGGATGAATACAATTCGGAAAATCCAAAAATCACAACGAGATGTTCTCATCATTTTCACCTCGGCTGTATTTATGAATGGTTGGAGAGAAGCGAAAGCTGTCCAATTTGTGGCAAGGAGATGGAGTTCTGCGAAAGCCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2 zf-rbx1

Protein Analysis

120

Amino Acids

13.52

Weight (kDa)

4.61

Isoelectric Point (pI)

58.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 66 - 109 1.1e-11 RING-H2 zinc finger domain
zf-RING_2 PF13639 68 - 109 9.9e-13 Ring finger domain
zf-ANAPC11 PF12861 68 - 115 2.9e-07 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-C3HC4_2 PF13923 69 - 109 2.5e-09 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 69 - 109 4.5e-07 Zinc finger, C3HC4 type (RING finger)
zf-RING_5 PF14634 69 - 111 1.6e-06 zinc-RING finger domain
zf-RING_UBOX PF13445 69 - 100 3.5e-06 RING-type zinc-finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 326
AcoI YGGCCR 1 cut(s) 115
AcuI CTGAAG 2 cut(s) 117, 210
AfaI GTAC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 326
AflIII ACRYGT 1 cut(s) 212
AjnI CCWGG 1 cut(s) 60
AloI GAACNNNNNNTCC 2 cut(s) 326, 358
AluBI AGCT 1 cut(s) 315
AluI AGCT 1 cut(s) 315
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 266
BalI TGGCCA 1 cut(s) 117
BccI CCATC 2 cut(s) 190, 331
BciT130I CCWGG 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 62
BmrFI CCNGG 1 cut(s) 62
BplI GAGNNNNNCTC 2 cut(s) 247, 279
BsaAI YACGTR 1 cut(s) 175
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 4 cut(s) 60, 61, 129, 277
BsaXI ACNNNNNCTCC 2 cut(s) 326, 356
Bsc4I CCNNNNNNNGG 1 cut(s) 326
BseBI CCWGG 1 cut(s) 62
BseDI CCNNGG 4 cut(s) 60, 61, 129, 277
BseGI GGATG 1 cut(s) 226
BseLI CCNNNNNNNGG 1 cut(s) 326
BseMII CTCAG 1 cut(s) 23
BshFI GGCC 1 cut(s) 117
BslI CCNNNNNNNGG 1 cut(s) 326
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 117
Bso31I GGTCTC 1 cut(s) 119
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 24
BspTNI GGTCTC 1 cut(s) 119
BssECI CCNNGG 4 cut(s) 60, 61, 129, 277
Bst2UI CCWGG 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 31
BstBAI YACGTR 1 cut(s) 175
BstDEI CTNAG 1 cut(s) 32
BstF5I GGATG 1 cut(s) 226
BstMAI GTCTC 1 cut(s) 119
BstNI CCWGG 1 cut(s) 62
BstNSI RCATGY 1 cut(s) 216
BstSCI CCNGG 1 cut(s) 60
BsuRI GGCC 1 cut(s) 117
BtsCI GGATG 1 cut(s) 226
Csp6I GTAC 1 cut(s) 51
CviAII CATG 1 cut(s) 213
CviJI RGCY 5 cut(s) 117, 140, 282, 315, 354
CviKI_1 RGCY 5 cut(s) 117, 140, 282, 315, 354
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 1 cut(s) 32
EaeI YGGCCR 1 cut(s) 115
Eam1104I CTCTTC 1 cut(s) 31
EarI CTCTTC 1 cut(s) 31
Eco31I GGTCTC 1 cut(s) 119
Eco57I CTGAAG 2 cut(s) 117, 210
EcoRII CCWGG 1 cut(s) 60
FaeI CATG 1 cut(s) 216
FaiI YATR 5 cut(s) 23, 160, 162, 214, 291
FatI CATG 1 cut(s) 212
FauNDI CATATG 1 cut(s) 160
FokI GGATG 1 cut(s) 233
HaeIII GGCC 1 cut(s) 117
Hin1II CATG 1 cut(s) 216
HinfI GANTC 2 cut(s) 4, 56
HphI GGTGA 1 cut(s) 266
Hpy188I TCNGA 3 cut(s) 133, 190, 235
Hpy188III TCNNGA 1 cut(s) 218
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 4 cut(s) 13, 25, 158, 178
HpyF3I CTNAG 1 cut(s) 32
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 1 cut(s) 216
LpnPI CCDG 4 cut(s) 33, 47, 74, 203
MaeII ACGT 1 cut(s) 174
MboII GAAGA 7 cut(s) 29, 48, 110, 113, 177, 203, 209
MfeI CAATTG 1 cut(s) 119
MlsI TGGCCA 1 cut(s) 117
MluCI AATT 3 cut(s) 119, 229, 321
MluNI TGGCCA 1 cut(s) 117
MmeI TCCRAC 1 cut(s) 279
MnlI CCTC 3 cut(s) 32, 139, 287
Mox20I TGGCCA 1 cut(s) 117
MscI TGGCCA 1 cut(s) 117
MseI TTAA 1 cut(s) 358
Msp20I TGGCCA 1 cut(s) 117
MspR9I CCNGG 1 cut(s) 62
MunI CAATTG 1 cut(s) 119
MvaI CCWGG 1 cut(s) 62
NdeI CATATG 1 cut(s) 160
NlaIII CATG 1 cut(s) 216
NmeAIII GCCGAG 1 cut(s) 258
NspI RCATGY 1 cut(s) 216
PasI CCCWGGG 1 cut(s) 61
PciI ACATGT 1 cut(s) 212
PfeI GAWTC 1 cut(s) 56
PflMI CCANNNNNTGG 1 cut(s) 326
Ppu21I YACGTR 1 cut(s) 175
PscI ACATGT 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 60
PspGI CCWGG 1 cut(s) 60
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
SaqAI TTAA 1 cut(s) 358
ScrFI CCNGG 1 cut(s) 62
SetI ASST 4 cut(s) 131, 177, 279, 317
Sse9I AATT 3 cut(s) 119, 229, 321
StyD4I CCNGG 1 cut(s) 60
TaiI ACGT 1 cut(s) 177
TasI AATT 3 cut(s) 119, 229, 321
TfiI GAWTC 1 cut(s) 56
Tru1I TTAA 1 cut(s) 358
Tru9I TTAA 1 cut(s) 358
TspDTI ATGAA 3 cut(s) 210, 237, 306
Van91I CCANNNNNTGG 1 cut(s) 326
XceI RCATGY 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.