Rh7AG038600

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Forward (+)
2610203 .. 2611189
987 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG038600.1

Sequence Viewer

Length: 375 bp
ATGGGTGGTCTGATTGCTGTAAAATTTGTTTTTGCAAATTGGGTTTTGGTTTTGAACCCTCTGACTGCTTCAAAATTTGATCTTTTCAAATGGGTTGATCTTGTTTACTTGATTTATAAAAGAGAAAAGGATATTTGCATGGATGAGTTTCAATTTGGTGAGACTTCAAATTTATTTCTCTGCGTTTTGTATGTTGGTTATGGCCTTCTTATGAGGAAAGAATATACTCTAGAAAACCCCAAAATAATGACAAAATGCTCTCATCATTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGACTTTGTTCGTACTCATGAGTCATGATAATTTTCAGCAGTCATAG

Protein Analysis

124

Amino Acids

14.6

Weight (kDa)

6.4

Isoelectric Point (pI)

29.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-C3HC4_2 PF13923 77 - 108 1.3e-07 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4 PF00097 77 - 108 2.4e-06 Zinc finger, C3HC4 type (RING finger)
zf-RING_2 PF13639 78 - 108 6.4e-09 Ring finger domain
zf-rbx1 PF12678 79 - 108 2e-09 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 117
AcsI RAATTY 3 cut(s) 23, 74, 169
AfaI GTAC 1 cut(s) 342
AgsI TTSAA 5 cut(s) 55, 72, 88, 152, 168
Alw26I GTCTC 1 cut(s) 155
AoxI GGCC 1 cut(s) 202
ApoI RAATTY 3 cut(s) 23, 74, 169
AsuHPI GGTGA 1 cut(s) 170
BccI CCATC 1 cut(s) 289
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 1 cut(s) 230
BseGI GGATG 2 cut(s) 148, 300
BshFI GGCC 1 cut(s) 204
BsmAI GTCTC 1 cut(s) 155
BsnI GGCC 1 cut(s) 204
Bsp143I GATC 2 cut(s) 79, 97
BspANI GGCC 1 cut(s) 204
BspHI TCATGA 2 cut(s) 345, 352
BssMI GATC 2 cut(s) 79, 97
BstF5I GGATG 2 cut(s) 148, 300
BstKTI GATC 2 cut(s) 82, 100
BstMAI GTCTC 1 cut(s) 155
BstMBI GATC 2 cut(s) 79, 97
BsuRI GGCC 1 cut(s) 204
BtsCI GGATG 2 cut(s) 148, 300
CciI TCATGA 2 cut(s) 345, 352
Csp6I GTAC 1 cut(s) 341
CviAII CATG 3 cut(s) 139, 346, 353
CviJI RGCY 1 cut(s) 204
CviKI_1 RGCY 1 cut(s) 204
CviQI GTAC 1 cut(s) 341
DpnI GATC 2 cut(s) 81, 99
DpnII GATC 2 cut(s) 79, 97
FaeI CATG 3 cut(s) 142, 349, 356
FatI CATG 3 cut(s) 138, 345, 352
FokI GGATG 2 cut(s) 155, 307
FspBI CTAG 1 cut(s) 230
HaeIII GGCC 1 cut(s) 204
Hin1II CATG 3 cut(s) 142, 349, 356
HinfI GANTC 1 cut(s) 349
HphI GGTGA 1 cut(s) 170
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 12, 63
Hpy188III TCNNGA 3 cut(s) 230, 346, 353
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 215
HpyCH4V TGCA 2 cut(s) 35, 138
Hsp92II CATG 3 cut(s) 142, 349, 356
Kzo9I GATC 2 cut(s) 79, 97
LpnPI CCDG 1 cut(s) 330
MaeI CTAG 1 cut(s) 230
MalI GATC 2 cut(s) 81, 99
MboI GATC 2 cut(s) 79, 97
MluCI AATT 6 cut(s) 23, 37, 74, 152, 169, 358
MlyI GAGTC 1 cut(s) 358
MnlI CCTC 2 cut(s) 69, 207
NdeII GATC 2 cut(s) 79, 97
NlaIII CATG 3 cut(s) 142, 349, 356
PagI TCATGA 2 cut(s) 345, 352
PleI GAGTC 1 cut(s) 357
PpsI GAGTC 1 cut(s) 357
PsiI TTATAA 1 cut(s) 117
RsaI GTAC 1 cut(s) 342
RsaNI GTAC 1 cut(s) 341
Sau3AI GATC 2 cut(s) 79, 97
SchI GAGTC 1 cut(s) 358
SgeI CNNG 9 cut(s) 113, 121, 151, 242, 287, 329, 340, 358, 365
Sse9I AATT 6 cut(s) 23, 37, 74, 152, 169, 358
SspMI CTAG 1 cut(s) 230
TasI AATT 6 cut(s) 23, 37, 74, 152, 169, 358
XapI RAATTY 3 cut(s) 23, 74, 169
XbaI TCTAGA 1 cut(s) 229
XspI CTAG 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.