Rroxscaffold_5G00379000

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Forward (+)
59518993 .. 59520611
1619 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00379000.1

Sequence Viewer

Length: 168 bp
ATGGAAGAGGAAGAATGCCCTACATGTCTTGAAGAATACACACCGGAAAATCCAAAGATAACAGCAAAGTGTTCTCACCATTTCCACCTTGCTTGTATATATGAATGGTTGGAGAGAAACCAAACATGTCCAGTTTGCAGCCAGGTGATGTCATTTAATGATCTCTGA

Protein Analysis

55

Amino Acids

6.48

Weight (kDa)

4.58

Isoelectric Point (pI)

70.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 3 - 46 6.4e-13 RING-H2 zinc finger domain
zf-RING_2 PF13639 5 - 46 6.8e-14 Ring finger domain
zf-C3HC4_2 PF13923 5 - 46 1e-08 Zinc finger, C3HC4 type (RING finger)
zf-RING_11 PF17123 5 - 33 2.1e-08 RING-like zinc finger
zf-RING_5 PF14634 5 - 48 1.1e-06 zinc-RING finger domain
zf-ANAPC11 PF12861 6 - 53 1.8e-09 Anaphase-promoting complex subunit 11 RING-H2 finger
zf-C3HC4 PF00097 6 - 46 6.6e-09 Zinc finger, C3HC4 type (RING finger)
zf-RING_UBOX PF13445 6 - 44 5.2e-09 RING-type zinc-finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 2 cut(s) 23, 125
AgsI TTSAA 1 cut(s) 32
AjnI CCWGG 1 cut(s) 141
ApeKI GCWGC 1 cut(s) 138
AsuHPI GGTGA 2 cut(s) 68, 157
BbvI GCAGC 1 cut(s) 150
BciT130I CCWGG 1 cut(s) 143
BisI GCNGC 1 cut(s) 139
BlsI GCNGC 1 cut(s) 140
Bme1390I CCNGG 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 143
BsaWI WCCGGW 1 cut(s) 43
Bse1I ACTGG 1 cut(s) 131
BseBI CCWGG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 131
BseXI GCAGC 1 cut(s) 150
BsiSI CCGG 1 cut(s) 44
BsmI GAATGC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 160
BsrI ACTGG 1 cut(s) 131
BssMI GATC 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 143
BstKTI GATC 1 cut(s) 163
BstMBI GATC 1 cut(s) 160
BstNI CCWGG 1 cut(s) 143
BstNSI RCATGY 2 cut(s) 27, 129
BstSCI CCNGG 1 cut(s) 141
BstV1I GCAGC 1 cut(s) 150
CspCI CAANNNNNGTGG 2 cut(s) 74, 109
CviAII CATG 2 cut(s) 24, 126
CviJI RGCY 1 cut(s) 141
CviKI_1 RGCY 1 cut(s) 141
DpnI GATC 1 cut(s) 162
DpnII GATC 1 cut(s) 160
EcoRII CCWGG 1 cut(s) 141
FaeI CATG 2 cut(s) 27, 129
FaiI YATR 5 cut(s) 25, 98, 100, 102, 127
FatI CATG 2 cut(s) 23, 125
Fnu4HI GCNGC 1 cut(s) 139
Fsp4HI GCNGC 1 cut(s) 139
GluI GCNGC 1 cut(s) 139
HapII CCGG 1 cut(s) 44
Hin1II CATG 2 cut(s) 27, 129
HpaII CCGG 1 cut(s) 44
HphI GGTGA 2 cut(s) 68, 157
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 29
HpyCH4V TGCA 1 cut(s) 138
Hsp92II CATG 2 cut(s) 27, 129
Kzo9I GATC 1 cut(s) 160
LpnPI CCDG 4 cut(s) 57, 128, 144, 155
Lsp1109I GCAGC 1 cut(s) 150
MalI GATC 1 cut(s) 162
MboI GATC 1 cut(s) 160
MboII GAAGA 3 cut(s) 17, 23, 44
MmeI TCCRAC 1 cut(s) 90
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 143
Mva1269I GAATGC 1 cut(s) 20
MvaI CCWGG 1 cut(s) 143
NdeII GATC 1 cut(s) 160
NlaIII CATG 2 cut(s) 27, 129
NspI RCATGY 2 cut(s) 27, 129
PciI ACATGT 2 cut(s) 23, 125
PctI GAATGC 1 cut(s) 20
PkrI GCNGC 1 cut(s) 140
PscI ACATGT 2 cut(s) 23, 125
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 1 cut(s) 139
Sau3AI GATC 1 cut(s) 160
ScrFI CCNGG 1 cut(s) 143
SetI ASST 2 cut(s) 90, 147
SgeI CNNG 9 cut(s) 36, 41, 56, 101, 105, 138, 143, 154, 155
StyD4I CCNGG 1 cut(s) 141
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseI GCWGC 1 cut(s) 138
TspDTI ATGAA 1 cut(s) 117
XceI RCATGY 2 cut(s) 27, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.