Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7D

Orthogroup ID

OG0002004

Physical Location & Seq

Genomic Coordinates Forward (+)

2833163 .. 2841963

Gene Structure 8801 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7DG038300.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

ATGTTCCTTTTCCAAAGCATCAATTCACTCACTGAATCCAAATTTTTACACTGGATTTCCGATTCCTGGGTGCCCCCTGTCTTTGTCCACCCACCAAGATCAATCTCTATCTCTCTCTCCATTCCACCTAAAGAATATACTCTAGAAAACCCCAAAATAATGACAAAATGCTCTCATCATTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGGTCATGGCATTCGATGAAACGACTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000209 GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006508 GO:0006511 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010498 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0019941 GO:0030163 GO:0032446 GO:0036211 GO:0043161 GO:0043170 GO:0043412 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0051603 GO:0061630 GO:0061659 GO:0070647 GO:0071704 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

zf-RING_2 zf-rbx1

Protein Analysis

89

Amino Acids

10.38

Weight (kDa)

6.16

Isoelectric Point (pI)

57.27

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
zf-RING_2	PF13639	47 - 79	2e-09	Ring finger domain
zf-C3HC4_2	PF13923	48 - 79	6.5e-08	Zinc finger, C3HC4 type (RING finger)
zf-C3HC4	PF00097	48 - 79	1.2e-06	Zinc finger, C3HC4 type (RING finger)
zf-rbx1	PF12678	50 - 79	6e-10	RING-H2 zinc finger domain
zf-ANAPC11	PF12861	51 - 86	1.9e-06	Anaphase-promoting complex subunit 11 RING-H2 finger

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002004)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69085
fragaria_vesca	FvH4_4g22510 FvH4_4g22510 FvH4_4g22510 FvH4_4g22510 FvH4_4g29590
malus_domestica	MD13G1059100.v1.1 MD13G1131900.v1.1 MD16G1142200.v1.1
prunus_persica	Prupe.1G213500_v2.0.a1 Prupe.1G213500_v2.0.a1 Prupe.1G290700_v2.0.a1
pyrus_communis	pycom13g05270 pycom13g11490 pycom16g11270
rosa_chinensis	RchiOBHm_Chr4g0428741 RchiOBHm_Chr4g0437831
rosa_laevigata	RLG00000006409 RLG00000007130
rosa_multiflora	Rmu_sc0004193.1_g000009 Rmu_sc0010032.1_g000003
rosa_roxburghii	Rroxscaffold_1G00025140 Rroxscaffold_2G00125470 Rroxscaffold_4G00303240 Rroxscaffold_4G00325060 Rroxscaffold_5G00370400 Rroxscaffold_5G00379000 Rroxscaffold_7G00190540
rosa_rugosa	Rorug04G0227900 Rorug04G0228000 Rorug04G0304000 Rorug04G0304100
rosa_samantha	Rh4AG285300 Rh4AG356400 Rh4BG291300 Rh4BG367300 Rh4CG307100 Rh4CG381300 Rh4DG288400 Rh4DG361600 Rh7AG038600 Rh7CG039800 Rh7DG038300
rosa_wichuraiana	Rw4G024740 Rw4G031430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	70
AcsI	RAATTY	1 cut(s)	41
AfiI	CCNNNNNNNGG	1 cut(s)	66
AjnI	CCWGG	1 cut(s)	65
ApoI	RAATTY	1 cut(s)	41
BaeGI	GKGCMC	1 cut(s)	75
BanI	GGYRCC	1 cut(s)	70
BccI	CCATC	1 cut(s)	202
BciT130I	CCWGG	1 cut(s)	67
BfaI	CTAG	1 cut(s)	143
Bme1390I	CCNGG	1 cut(s)	67
BmiI	GGNNCC	1 cut(s)	72
BmrFI	CCNGG	1 cut(s)	67
BmsI	GCATC	1 cut(s)	27
BsaJI	CCNNGG	1 cut(s)	66
Bsc4I	CCNNNNNNNGG	1 cut(s)	66
Bse1I	ACTGG	1 cut(s)	56
BseBI	CCWGG	1 cut(s)	67
BseDI	CCNNGG	1 cut(s)	66
BseGI	GGATG	1 cut(s)	213
BseLI	CCNNNNNNNGG	1 cut(s)	66
BseNI	ACTGG	1 cut(s)	56
BseSI	GKGCMC	1 cut(s)	75
BshNI	GGYRCC	1 cut(s)	70
BslI	CCNNNNNNNGG	1 cut(s)	66
BsmI	GAATGC	1 cut(s)	251
Bsp1286I	GDGCHC	1 cut(s)	75
Bsp143I	GATC	1 cut(s)	98
BspLI	GGNNCC	1 cut(s)	72
BspT107I	GGYRCC	1 cut(s)	70
BsrI	ACTGG	1 cut(s)	56
BssECI	CCNNGG	1 cut(s)	66
BssMI	GATC	1 cut(s)	98
Bst2UI	CCWGG	1 cut(s)	67
BstF5I	GGATG	1 cut(s)	213
BstKTI	GATC	1 cut(s)	101
BstMBI	GATC	1 cut(s)	98
BstNI	CCWGG	1 cut(s)	67
BstSCI	CCNGG	1 cut(s)	65
BstSLI	GKGCMC	1 cut(s)	75
BtsCI	GGATG	1 cut(s)	213
BtsIMutI	CAGTG	2 cut(s)	30, 49
CviAII	CATG	1 cut(s)	247
DpnI	GATC	1 cut(s)	100
DpnII	GATC	1 cut(s)	98
EcoRII	CCWGG	1 cut(s)	65
FaeI	CATG	1 cut(s)	250
FaiI	YATR	5 cut(s)	138, 197, 199, 201, 248
FatI	CATG	1 cut(s)	246
FokI	GGATG	1 cut(s)	220
FspBI	CTAG	1 cut(s)	143
Hin1II	CATG	1 cut(s)	250
HinfI	GANTC	2 cut(s)	35, 62
Hpy166II	GTNNAC	1 cut(s)	88
Hpy188I	TCNGA	1 cut(s)	61
Hpy188III	TCNNGA	1 cut(s)	143
Hpy8I	GTNNAC	1 cut(s)	88
Hsp92II	CATG	1 cut(s)	250
Kzo9I	GATC	1 cut(s)	98
LpnPI	CCDG	5 cut(s)	37, 52, 79, 90, 243
LweI	GCATC	1 cut(s)	27
MaeI	CTAG	1 cut(s)	143
MalI	GATC	1 cut(s)	100
MboI	GATC	1 cut(s)	98
MhlI	GDGCHC	1 cut(s)	75
MluCI	AATT	2 cut(s)	22, 41
MseI	TTAA	1 cut(s)	268
MspR9I	CCNGG	1 cut(s)	67
Mva1269I	GAATGC	1 cut(s)	251
MvaI	CCWGG	1 cut(s)	67
NdeII	GATC	1 cut(s)	98
NlaIII	CATG	1 cut(s)	250
NlaIV	GGNNCC	1 cut(s)	72
PctI	GAATGC	1 cut(s)	251
PfeI	GAWTC	2 cut(s)	35, 62
Psp6I	CCWGG	1 cut(s)	65
PspGI	CCWGG	1 cut(s)	65
PspN4I	GGNNCC	1 cut(s)	72
SaqAI	TTAA	1 cut(s)	268
Sau3AI	GATC	1 cut(s)	98
ScrFI	CCNGG	1 cut(s)	67
SduI	GDGCHC	1 cut(s)	75
SetI	ASST	2 cut(s)	130, 246
SfaNI	GCATC	1 cut(s)	27
Sse9I	AATT	2 cut(s)	22, 41
SspMI	CTAG	1 cut(s)	143
StyD4I	CCNGG	1 cut(s)	65
TaqI	TCGA	1 cut(s)	255
TasI	AATT	2 cut(s)	22, 41
TfiI	GAWTC	2 cut(s)	35, 62
Tru1I	TTAA	1 cut(s)	268
Tru9I	TTAA	1 cut(s)	268
TscAI	CASTG	2 cut(s)	37, 56
TspRI	CASTG	2 cut(s)	37, 56
XapI	RAATTY	1 cut(s)	41
XbaI	TCTAGA	1 cut(s)	142
XspI	CTAG	1 cut(s)	143

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.