RchiOBHm_Chr5g0018751

Brf1-like TBP-binding domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
13253718 .. 13255734
2017 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 300 bp
ATGCAGAGGCCAAGTTCAAAAATCAACTATGAGGCCTTGAAGAAATTAAATGAAGAGGATGGTAAACATGCAGCTGACTTTGAAGAAGGCAGCCATGGTGATATGCAGCACTCAAATGACAAATTCGACGGTGAAGCACAAAGTTTTAGAGGCAGTTATGATGATGAGTTGGATAATGAACATGCATATAGTGAAGATGCTGAAGGCAGACAAGGCTATGAAGACGAAGATACATATTTTCCAAATGATGGTTATAATGAATATGGCTGTGAGGATGAGTATTGTTTTGACGACTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.49

Weight (kDa)

4.08

Isoelectric Point (pI)

29.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 255
AccB7I CCANNNNNTGG 1 cut(s) 248
AcsI RAATTY 1 cut(s) 122
AcuI CTGAAG 1 cut(s) 222
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 3 cut(s) 18, 40, 83
AluBI AGCT 1 cut(s) 74
AluI AGCT 1 cut(s) 74
AoxI GGCC 2 cut(s) 8, 33
ApeKI GCWGC 3 cut(s) 71, 90, 106
ApoI RAATTY 1 cut(s) 122
AsuHPI GGTGA 2 cut(s) 110, 143
BbsI GAAGAC 1 cut(s) 228
BbvI GCAGC 3 cut(s) 83, 102, 118
BccI CCATC 2 cut(s) 53, 242
BisI GCNGC 3 cut(s) 72, 91, 107
BlsI GCNGC 3 cut(s) 73, 92, 108
BmsI GCATC 1 cut(s) 187
BpiI GAAGAC 1 cut(s) 228
BsaJI CCNNGG 1 cut(s) 94
Bsc4I CCNNNNNNNGG 1 cut(s) 248
BseDI CCNNGG 1 cut(s) 94
BseGI GGATG 2 cut(s) 64, 280
BseLI CCNNNNNNNGG 1 cut(s) 248
BseXI GCAGC 3 cut(s) 83, 102, 118
BshFI GGCC 2 cut(s) 10, 35
BslI CCNNNNNNNGG 1 cut(s) 248
BsnI GGCC 2 cut(s) 10, 35
Bsp19I CCATGG 1 cut(s) 94
BspANI GGCC 2 cut(s) 10, 35
BssECI CCNNGG 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 94
Bst4CI ACNGT 1 cut(s) 131
Bst6I CTCTTC 1 cut(s) 48
BstDSI CCRYGG 1 cut(s) 94
BstF5I GGATG 2 cut(s) 64, 280
BstMWI GCNNNNNNNGC 1 cut(s) 213
BstNSI RCATGY 2 cut(s) 71, 185
BstV1I GCAGC 3 cut(s) 83, 102, 118
BstV2I GAAGAC 1 cut(s) 228
BsuRI GGCC 2 cut(s) 10, 35
BtgI CCRYGG 1 cut(s) 94
BtsCI GGATG 2 cut(s) 64, 280
CviAII CATG 3 cut(s) 68, 95, 182
CviJI RGCY 6 cut(s) 10, 35, 74, 93, 216, 267
CviKI_1 RGCY 6 cut(s) 10, 35, 74, 93, 216, 267
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco130I CCWWGG 1 cut(s) 94
Eco147I AGGCCT 1 cut(s) 35
Eco57I CTGAAG 1 cut(s) 222
EcoT14I CCWWGG 1 cut(s) 94
EcoT22I ATGCAT 1 cut(s) 187
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 3 cut(s) 71, 98, 185
FatI CATG 3 cut(s) 67, 94, 181
Fnu4HI GCNGC 3 cut(s) 72, 91, 107
FokI GGATG 2 cut(s) 71, 287
Fsp4HI GCNGC 3 cut(s) 72, 91, 107
GluI GCNGC 3 cut(s) 72, 91, 107
HaeIII GGCC 2 cut(s) 10, 35
Hin1II CATG 3 cut(s) 71, 98, 185
HphI GGTGA 2 cut(s) 110, 143
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 299
Hpy8I GTNNAC 1 cut(s) 65
Hpy99I CGWCG 1 cut(s) 131
HpyAV CCTTC 2 cut(s) 80, 197
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 4 cut(s) 4, 71, 106, 185
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
Hsp92II CATG 3 cut(s) 71, 98, 185
Lsp1109I GCAGC 3 cut(s) 83, 102, 118
LweI GCATC 1 cut(s) 187
MboII GAAGA 6 cut(s) 52, 65, 95, 206, 233, 239
MluCI AATT 2 cut(s) 44, 122
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 4 cut(s) 25, 49, 143, 265
Mph1103I ATGCAT 1 cut(s) 187
MseI TTAA 1 cut(s) 47
MslI CAYNNNNRTG 1 cut(s) 114
MspA1I CMGCKG 1 cut(s) 74
MwoI GCNNNNNNNGC 1 cut(s) 213
NcoI CCATGG 1 cut(s) 94
NlaIII CATG 3 cut(s) 71, 98, 185
NsiI ATGCAT 1 cut(s) 187
NspI RCATGY 2 cut(s) 71, 185
PceI AGGCCT 1 cut(s) 35
PflMI CCANNNNNTGG 1 cut(s) 248
PkrI GCNGC 3 cut(s) 73, 92, 108
PsiI TTATAA 1 cut(s) 255
PvuII CAGCTG 1 cut(s) 74
RseI CAYNNNNRTG 1 cut(s) 114
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 3 cut(s) 72, 91, 107
SetI ASST 1 cut(s) 76
SfaNI GCATC 1 cut(s) 187
SgeI CNNG 6 cut(s) 24, 49, 80, 107, 194, 224
SmiMI CAYNNNNRTG 1 cut(s) 114
Sse9I AATT 2 cut(s) 44, 122
SseBI AGGCCT 1 cut(s) 35
StuI AGGCCT 1 cut(s) 35
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 131
TaqI TCGA 1 cut(s) 126
TasI AATT 2 cut(s) 44, 122
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TseI GCWGC 3 cut(s) 71, 90, 106
TspDTI ATGAA 4 cut(s) 66, 192, 234, 273
Van91I CCANNNNNTGG 1 cut(s) 248
XapI RAATTY 1 cut(s) 122
XceI RCATGY 2 cut(s) 71, 185
Zsp2I ATGCAT 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.