RchiOBHm_Chr5g0038431

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0002054
Physical Location & Seq
Forward (+)
33019994 .. 33020227
234 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 234 bp
ATGGCTTCTCTCCACCAAACTACCTGGAAGAGAGCTGGTATTCATGAAGCCATCATCAATTCGACTTTTGAGTTCAAAAGGAAAACCAACTTGGTATATGGTCTTTCAGAGAAATGGTGTTGTGAGACCAACACATTCATTTTCCCTTGGGGTGAAGCAACCAACGTTATTGGAGGATATGATGGTTTTGGGAGGCTTTTAGGTTTTGGGAGACTCTGTTTTCAGTTCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMD

Protein Analysis

77

Amino Acids

8.81

Weight (kDa)

8.57

Isoelectric Point (pI)

15.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMD PF10536 13 - 54 4.4e-14 Plant mobile domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 165
AgsI TTSAA 1 cut(s) 76
AjnI CCWGG 1 cut(s) 23
AjuI GAANNNNNNNTTGG 2 cut(s) 74, 106
AluBI AGCT 1 cut(s) 35
AluI AGCT 1 cut(s) 35
Alw26I GTCTC 2 cut(s) 119, 205
AsuHPI GGTGA 1 cut(s) 164
BccI CCATC 2 cut(s) 59, 176
BciT130I CCWGG 1 cut(s) 25
BcoDI GTCTC 2 cut(s) 119, 205
Bme1390I CCNGG 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 25
BsaI GGTCTC 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 146
BsaXI ACNNNNNCTCC 2 cut(s) 202, 232
BseBI CCWGG 1 cut(s) 25
BseDI CCNNGG 1 cut(s) 146
BsmAI GTCTC 2 cut(s) 119, 205
Bso31I GGTCTC 1 cut(s) 119
BspHI TCATGA 1 cut(s) 43
BspTNI GGTCTC 1 cut(s) 119
BssECI CCNNGG 1 cut(s) 146
BssT1I CCWWGG 1 cut(s) 146
Bst2UI CCWGG 1 cut(s) 25
Bst6I CTCTTC 1 cut(s) 23
BstMAI GTCTC 2 cut(s) 119, 205
BstNI CCWGG 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 23
CciI TCATGA 1 cut(s) 43
CviAII CATG 1 cut(s) 44
CviJI RGCY 4 cut(s) 5, 35, 50, 196
CviKI_1 RGCY 4 cut(s) 5, 35, 50, 196
Eam1104I CTCTTC 1 cut(s) 23
EarI CTCTTC 1 cut(s) 23
Eco130I CCWWGG 1 cut(s) 146
Eco31I GGTCTC 1 cut(s) 119
EcoRII CCWGG 1 cut(s) 23
EcoT14I CCWWGG 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 146
FaeI CATG 1 cut(s) 47
FaiI YATR 4 cut(s) 45, 97, 99, 180
FatI CATG 1 cut(s) 43
Hin1II CATG 1 cut(s) 47
HinfI GANTC 1 cut(s) 213
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 228
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 44
Hpy8I GTNNAC 1 cut(s) 228
HpyCH4IV ACGT 1 cut(s) 165
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 1 cut(s) 47
LpnPI CCDG 3 cut(s) 10, 21, 37
MaeII ACGT 1 cut(s) 165
MboII GAAGA 1 cut(s) 40
MluCI AATT 1 cut(s) 58
MlyI GAGTC 1 cut(s) 207
MnlI CCTC 2 cut(s) 167, 186
MspR9I CCNGG 1 cut(s) 25
MvaI CCWGG 1 cut(s) 25
NlaIII CATG 1 cut(s) 47
PagI TCATGA 1 cut(s) 43
PleI GAGTC 1 cut(s) 207
PpsI GAGTC 1 cut(s) 207
Psp1406I AACGTT 1 cut(s) 165
Psp6I CCWGG 1 cut(s) 23
PspGI CCWGG 1 cut(s) 23
SchI GAGTC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 25
SetI ASST 4 cut(s) 26, 37, 168, 205
SgeI CNNG 6 cut(s) 36, 37, 48, 56, 103, 159
Sse9I AATT 1 cut(s) 58
StyD4I CCNGG 1 cut(s) 23
StyI CCWWGG 1 cut(s) 146
TaiI ACGT 1 cut(s) 168
TaqI TCGA 1 cut(s) 62
TasI AATT 1 cut(s) 58
TspDTI ATGAA 3 cut(s) 32, 60, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.