RchiOBHm_Chr2g0092391

PHD-finger

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
5917364 .. 5917897
534 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 276 bp
ATGTCTGGCAGTAACTTGATGGATATATGGGACTGTTTATGTCAGAATCTCGAAATAAGGGATGTTACCTTGGAGGTTGTTTCCAAGAAAGGGAATGTTGATCTTCGCTTGCTTTGTGGGGTGGCTCACGGAAGATCCTGGTTCGATAGGTGGGGATACAAATTTTGGAGAGGGAGTTATGGAGTAGATGAAGTGAAGTATGAGATTGCCCTAGCTTATCTCCGTAACCTTAACATTTATCAGGTTGCAACAAGGTGGAGGACCAATATGCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.72

Weight (kDa)

8.52

Isoelectric Point (pI)

32.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 129
AcsI RAATTY 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 90
AjnI CCWGG 1 cut(s) 137
AluBI AGCT 1 cut(s) 215
AluI AGCT 1 cut(s) 215
AlwI GGATC 1 cut(s) 129
ApoI RAATTY 1 cut(s) 161
AspS9I GGNCC 1 cut(s) 261
AvaII GGWCC 1 cut(s) 261
BccI CCATC 1 cut(s) 13
BciT130I CCWGG 1 cut(s) 139
BciVI GTATCC 1 cut(s) 149
BfaI CTAG 2 cut(s) 212, 274
BfuI GTATCC 1 cut(s) 149
Bme1390I CCNGG 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 139
BsaJI CCNNGG 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 160, 190
Bsc4I CCNNNNNNNGG 1 cut(s) 90
BseBI CCWGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 90
BslFI GGGAC 1 cut(s) 44
BslI CCNNNNNNNGG 1 cut(s) 90
BsmFI GGGAC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 100, 134
BspPI GGATC 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 69
BssMI GATC 2 cut(s) 100, 134
BssT1I CCWWGG 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 139
Bst4CI ACNGT 1 cut(s) 35
BstC8I GCNNGC 1 cut(s) 110
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 2 cut(s) 103, 137
BstMBI GATC 2 cut(s) 100, 134
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
BsuI GTATCC 1 cut(s) 149
BtsCI GGATG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 110
Cfr13I GGNCC 1 cut(s) 261
CviJI RGCY 2 cut(s) 125, 215
CviKI_1 RGCY 2 cut(s) 125, 215
DpnI GATC 2 cut(s) 102, 136
DpnII GATC 2 cut(s) 100, 134
Eco130I CCWWGG 1 cut(s) 69
Eco47I GGWCC 1 cut(s) 261
EcoRII CCWGG 1 cut(s) 137
EcoT14I CCWWGG 1 cut(s) 69
ErhI CCWWGG 1 cut(s) 69
FaiI YATR 6 cut(s) 26, 28, 40, 180, 201, 269
FaqI GGGAC 1 cut(s) 44
FokI GGATG 1 cut(s) 74
FspBI CTAG 2 cut(s) 212, 274
HinfI GANTC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 45
Hpy188III TCNNGA 1 cut(s) 50
HpyCH4III ACNGT 1 cut(s) 35
HpyCH4V TGCA 1 cut(s) 248
Kzo9I GATC 2 cut(s) 100, 134
LpnPI CCDG 3 cut(s) 124, 151, 227
MaeI CTAG 2 cut(s) 212, 274
MaeIII GTNAC 3 cut(s) 11, 64, 224
MalI GATC 2 cut(s) 102, 136
MboI GATC 2 cut(s) 100, 134
MboII GAAGA 2 cut(s) 95, 144
MflI RGATCY 1 cut(s) 134
MluCI AATT 1 cut(s) 161
MnlI CCTC 3 cut(s) 67, 164, 252
MseI TTAA 1 cut(s) 231
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
NdeII GATC 2 cut(s) 100, 134
PfeI GAWTC 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
PspPI GGNCC 1 cut(s) 261
PsuI RGATCY 1 cut(s) 134
SaqAI TTAA 1 cut(s) 231
Sau3AI GATC 2 cut(s) 100, 134
Sau96I GGNCC 1 cut(s) 261
ScrFI CCNGG 1 cut(s) 139
SetI ASST 7 cut(s) 71, 78, 152, 217, 231, 246, 257
SinI GGWCC 1 cut(s) 261
Sse9I AATT 1 cut(s) 161
SspMI CTAG 2 cut(s) 212, 274
StyD4I CCNGG 1 cut(s) 137
StyI CCWWGG 1 cut(s) 69
TaaI ACNGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 51, 144
TasI AATT 1 cut(s) 161
TfiI GAWTC 1 cut(s) 46
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TspDTI ATGAA 1 cut(s) 204
TspGWI ACGGA 2 cut(s) 144, 212
VpaK11BI GGWCC 1 cut(s) 261
XapI RAATTY 1 cut(s) 161
XspI CTAG 2 cut(s) 212, 274
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.