RchiOBHm_Chr2g0168161

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
82616723 .. 82618615
1893 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGTTGTCCCCATCGACTCTGTACAAAGCTTACCTTGTGGTCAAGTTTGCTCGAAATGCTTTTGGATTTAAACACCTACCTGGGGAGGTCTCTGTAGGTCTGGAGGGAGGAGAACGTACTAAGCAGACTCTGCTTCTTCACATCGATGGAAAACTACGAAAGAGAGATGGCTTACTCAAAAGAGAGGGGTGA
Functional Annotation

Protein Analysis

63

Amino Acids

7.04

Weight (kDa)

10.09

Isoelectric Point (pI)

40.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 1 - 49 4.6e-07 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 23, 118
AfiI CCNNNNNNNGG 1 cut(s) 82
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
Alw26I GTCTC 1 cut(s) 94
AlwNI CAGNNNCTG 1 cut(s) 130
BccI CCATC 3 cut(s) 19, 140, 161
BciT130I CCWGG 1 cut(s) 81
BcoDI GTCTC 1 cut(s) 94
BfmI CTRYAG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 81
BmrFI CCNGG 1 cut(s) 81
BpmI CTGGAG 1 cut(s) 122
Bsa29I ATCGAT 1 cut(s) 144
BsaI GGTCTC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 81
BseCI ATCGAT 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 80
BseLI CCNNNNNNNGG 1 cut(s) 82
BseRI GAGGAG 1 cut(s) 123
BshVI ATCGAT 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 82
BsmAI GTCTC 1 cut(s) 94
Bso31I GGTCTC 1 cut(s) 94
Bsp1407I TGTACA 1 cut(s) 21
BspDI ATCGAT 1 cut(s) 144
BspTNI GGTCTC 1 cut(s) 94
BsrGI TGTACA 1 cut(s) 21
BssECI CCNNGG 1 cut(s) 80
Bst2UI CCWGG 1 cut(s) 81
BstAPI GCANNNNNTGC 1 cut(s) 130
BstAUI TGTACA 1 cut(s) 21
BstDEI CTNAG 1 cut(s) 120
BstMAI GTCTC 1 cut(s) 94
BstMWI GCNNNNNNNGC 2 cut(s) 56, 130
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 93
Bsu15I ATCGAT 1 cut(s) 144
BsuTUI ATCGAT 1 cut(s) 144
CaiI CAGNNNCTG 1 cut(s) 130
ClaI ATCGAT 1 cut(s) 144
Csp6I GTAC 2 cut(s) 22, 117
CviJI RGCY 2 cut(s) 29, 171
CviKI_1 RGCY 2 cut(s) 29, 171
CviQI GTAC 2 cut(s) 22, 117
DdeI CTNAG 1 cut(s) 120
DraI TTTAAA 1 cut(s) 70
Eco31I GGTCTC 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 79
FalI AAGNNNNNCTT 2 cut(s) 18, 50
GsuI CTGGAG 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 27
HinfI GANTC 2 cut(s) 16, 127
Hpy188III TCNNGA 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 115
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 130
HpyF3I CTNAG 1 cut(s) 120
HpySE526I ACGT 1 cut(s) 115
LpnPI CCDG 3 cut(s) 66, 86, 93
MaeII ACGT 1 cut(s) 115
MboII GAAGA 1 cut(s) 128
MlyI GAGTC 2 cut(s) 10, 121
MnlI CCTC 4 cut(s) 79, 97, 101, 178
MseI TTAA 1 cut(s) 69
MslI CAYNNNNRTG 1 cut(s) 144
MspR9I CCNGG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 81
MwoI GCNNNNNNNGC 2 cut(s) 56, 130
PleI GAGTC 2 cut(s) 10, 121
PpsI GAGTC 2 cut(s) 10, 121
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PstNI CAGNNNCTG 1 cut(s) 130
RsaI GTAC 2 cut(s) 23, 118
RsaNI GTAC 2 cut(s) 22, 117
RseI CAYNNNNRTG 1 cut(s) 144
SaqAI TTAA 1 cut(s) 69
SchI GAGTC 2 cut(s) 10, 121
ScrFI CCNGG 1 cut(s) 81
SetI ASST 7 cut(s) 31, 36, 78, 82, 90, 100, 118
SfcI CTRYAG 1 cut(s) 93
SgeI CNNG 6 cut(s) 47, 55, 63, 92, 93, 113
SmiMI CAYNNNNRTG 1 cut(s) 144
StyD4I CCNGG 1 cut(s) 79
TaiI ACGT 1 cut(s) 118
TaqI TCGA 3 cut(s) 14, 52, 144
TatI WGTACW 1 cut(s) 21
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.