Rorug07G0121100

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
9462477 .. 9464605
2129 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0121100.1

Sequence Viewer

Length: 300 bp
ATGTTACAGTTTCCAGGCTTCATGAAACAGTATCCGTGGTCAACCAGGACAATTCCGACGTCGTTTCTGCTGCCGTCTCAATGGCCCCAACCCCACAGCGAAGAGCTCCTCCTCGCTATGGAGGAGGCCGATTACGACGAAAAGTGTAATGAAATCCGAAAGAGCCACAGCAACCAGATTATGATTGGGAAACCGACTGTTGATGTTGATAAAGAAGACTATGATAATGATGCTGATGATGATGATGTGGACAATGCAGAGGATTCTGAGGGCGAAGAGTTTGAACAGGAAACCGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.46

Weight (kDa)

4.05

Isoelectric Point (pI)

45.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ANAPC15 PF15243 8 - 97 2.1e-17 Anaphase-promoting complex subunit 15
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 62
AcyI GRCGYC 1 cut(s) 59
AfiI CCNNNNNNNGG 1 cut(s) 118
AgeI ACCGGT 1 cut(s) 293
AgsI TTSAA 1 cut(s) 284
AjnI CCWGG 2 cut(s) 13, 44
AluBI AGCT 1 cut(s) 106
AluI AGCT 1 cut(s) 106
Alw21I GWGCWC 1 cut(s) 108
Alw26I GTCTC 1 cut(s) 81
AoxI GGCC 2 cut(s) 83, 126
ApeKI GCWGC 1 cut(s) 70
AsiGI ACCGGT 1 cut(s) 293
AspS9I GGNCC 1 cut(s) 84
BanII GRGCYC 1 cut(s) 108
BbsI GAAGAC 1 cut(s) 222
Bbv12I GWGCWC 1 cut(s) 108
BbvI GCAGC 1 cut(s) 57
BceAI ACGGC 1 cut(s) 58
BciT130I CCWGG 2 cut(s) 15, 46
BciVI GTATCC 1 cut(s) 42
BcoDI GTCTC 1 cut(s) 81
BfuI GTATCC 1 cut(s) 42
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
Bme1390I CCNGG 2 cut(s) 15, 46
BmgT120I GGNCC 1 cut(s) 84
BmiI GGNNCC 1 cut(s) 86
BmrFI CCNGG 2 cut(s) 15, 46
BmsI GCATC 1 cut(s) 220
BpiI GAAGAC 1 cut(s) 222
BsaHI GRCGYC 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 35
BsaWI WCCGGW 1 cut(s) 293
Bsc4I CCNNNNNNNGG 1 cut(s) 118
Bse118I RCCGGY 1 cut(s) 293
BseBI CCWGG 2 cut(s) 15, 46
BseDI CCNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 258
BseRI GAGGAG 3 cut(s) 98, 101, 137
BseXI GCAGC 1 cut(s) 57
BshFI GGCC 2 cut(s) 85, 128
BshTI ACCGGT 1 cut(s) 293
BsiHKAI GWGCWC 1 cut(s) 108
BsiSI CCGG 1 cut(s) 294
BslI CCNNNNNNNGG 1 cut(s) 118
BsmAI GTCTC 1 cut(s) 81
BsmBI CGTCTC 1 cut(s) 81
BsnI GGCC 2 cut(s) 85, 128
Bsp1286I GDGCHC 1 cut(s) 108
BspANI GGCC 2 cut(s) 85, 128
BspCNI CTCAG 1 cut(s) 259
BspHI TCATGA 1 cut(s) 21
BspLI GGNNCC 1 cut(s) 86
BspQI GCTCTTC 1 cut(s) 96
BsrFI RCCGGY 1 cut(s) 293
BssAI RCCGGY 1 cut(s) 293
BssECI CCNNGG 1 cut(s) 35
BssNI GRCGYC 1 cut(s) 59
Bst2UI CCWGG 2 cut(s) 15, 46
Bst4CI ACNGT 3 cut(s) 9, 30, 199
Bst6I CTCTTC 2 cut(s) 96, 270
BstACI GRCGYC 1 cut(s) 59
BstDEI CTNAG 1 cut(s) 267
BstDSI CCRYGG 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 81
BstNI CCWGG 2 cut(s) 15, 46
BstSCI CCNGG 2 cut(s) 13, 44
BstV1I GCAGC 1 cut(s) 57
BstV2I GAAGAC 1 cut(s) 222
BsuI GTATCC 1 cut(s) 42
BsuRI GGCC 2 cut(s) 85, 128
BtgI CCRYGG 1 cut(s) 35
CciI TCATGA 1 cut(s) 21
Cfr10I RCCGGY 1 cut(s) 293
Cfr13I GGNCC 1 cut(s) 84
CspAI ACCGGT 1 cut(s) 293
CviAII CATG 1 cut(s) 22
CviJI RGCY 5 cut(s) 18, 85, 106, 128, 165
CviKI_1 RGCY 5 cut(s) 18, 85, 106, 128, 165
DdeI CTNAG 1 cut(s) 267
Eam1104I CTCTTC 2 cut(s) 96, 270
EarI CTCTTC 2 cut(s) 96, 270
Ecl136II GAGCTC 1 cut(s) 106
Eco24I GRGCYC 1 cut(s) 108
Eco53kI GAGCTC 1 cut(s) 106
EcoICRI GAGCTC 1 cut(s) 106
EcoRII CCWGG 2 cut(s) 13, 44
EcoT38I GRGCYC 1 cut(s) 108
Esp3I CGTCTC 1 cut(s) 81
FaeI CATG 1 cut(s) 25
FaiI YATR 4 cut(s) 23, 119, 182, 222
FatI CATG 1 cut(s) 21
Fnu4HI GCNGC 1 cut(s) 71
FriOI GRGCYC 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 71
HaeIII GGCC 2 cut(s) 85, 128
HapII CCGG 1 cut(s) 294
Hin1I GRCGYC 1 cut(s) 59
Hin1II CATG 1 cut(s) 25
HincII GTYRAC 1 cut(s) 42
HindII GTYRAC 1 cut(s) 42
HinfI GANTC 1 cut(s) 263
HpaII CCGG 1 cut(s) 294
Hpy166II GTNNAC 2 cut(s) 42, 250
Hpy188I TCNGA 3 cut(s) 57, 158, 268
Hpy188III TCNNGA 1 cut(s) 22
Hpy8I GTNNAC 2 cut(s) 42, 250
Hpy99I CGWCG 3 cut(s) 61, 64, 140
HpyCH4III ACNGT 3 cut(s) 9, 30, 199
HpyCH4IV ACGT 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 257
HpyF3I CTNAG 1 cut(s) 267
HpySE526I ACGT 1 cut(s) 59
Hsp92I GRCGYC 1 cut(s) 59
Hsp92II CATG 1 cut(s) 25
LguI GCTCTTC 1 cut(s) 96
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 27, 31, 58, 188, 272
Lsp1109I GCAGC 1 cut(s) 57
LweI GCATC 1 cut(s) 220
MaeII ACGT 1 cut(s) 59
MaeIII GTNAC 1 cut(s) 3
MboII GAAGA 3 cut(s) 113, 227, 287
MhlI GDGCHC 1 cut(s) 108
MluCI AATT 1 cut(s) 51
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 6 cut(s) 115, 118, 119, 122, 253, 262
MspI CCGG 1 cut(s) 294
MspR9I CCNGG 2 cut(s) 15, 46
MvaI CCWGG 2 cut(s) 15, 46
NlaIII CATG 1 cut(s) 25
NlaIV GGNNCC 1 cut(s) 86
PagI TCATGA 1 cut(s) 21
PciSI GCTCTTC 1 cut(s) 96
PfeI GAWTC 1 cut(s) 263
PinAI ACCGGT 1 cut(s) 293
PkrI GCNGC 1 cut(s) 72
Psp124BI GAGCTC 1 cut(s) 108
Psp6I CCWGG 2 cut(s) 13, 44
PspGI CCWGG 2 cut(s) 13, 44
PspN4I GGNNCC 1 cut(s) 86
PspPI GGNCC 1 cut(s) 84
SacI GAGCTC 1 cut(s) 108
SapI GCTCTTC 1 cut(s) 96
SatI GCNGC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 84
ScrFI CCNGG 2 cut(s) 15, 46
SduI GDGCHC 1 cut(s) 108
SetI ASST 2 cut(s) 62, 108
SfaNI GCATC 1 cut(s) 220
SgeI CNNG 8 cut(s) 26, 27, 34, 48, 57, 58, 125, 187
Sse9I AATT 1 cut(s) 51
SstI GAGCTC 1 cut(s) 108
StyD4I CCNGG 2 cut(s) 13, 44
TaaI ACNGT 3 cut(s) 9, 30, 199
TaiI ACGT 1 cut(s) 62
TasI AATT 1 cut(s) 51
TfiI GAWTC 1 cut(s) 263
TseI GCWGC 1 cut(s) 70
TspDTI ATGAA 3 cut(s) 10, 38, 165
TspGWI ACGGA 1 cut(s) 24
XcmI CCANNNNNNNNNTGG 1 cut(s) 182
ZraI GACGTC 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.