RchiOBHm_Chr1g0316701

isoform X1

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
4227026 .. 4228053
1028 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGCTTGAAACCCATCTATATGTGATCACATCTACTCTGGAGCAAAGATGTTACAAGGACTTGAGAACTGAGAACTTCCACTCTGTGAAAGTGGTCATGTGTATCTACCGGAAGTTGTTGATTTCTTTTAAGGATCAAATAATTTCCTATAGCCAGATAATCAGATGGAAGCAGAGCACAATTGTGGCTTATAACTTCCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

8.14

Weight (kDa)

9.3

Isoelectric Point (pI)

26.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 192
AclWI GGATC 1 cut(s) 141
AdeI CACNNNGTG 1 cut(s) 85
AgsI TTSAA 1 cut(s) 8
AleI CACNNNNGTG 1 cut(s) 182
Alw21I GWGCWC 1 cut(s) 179
AlwI GGATC 1 cut(s) 141
Bbv12I GWGCWC 1 cut(s) 179
BccI CCATC 2 cut(s) 21, 159
BclI TGATCA 1 cut(s) 24
BfmI CTRYAG 1 cut(s) 148
BpmI CTGGAG 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 82
BsaWI WCCGGW 1 cut(s) 108
BseMII CTCAG 1 cut(s) 60
BsiHKAI GWGCWC 1 cut(s) 179
BsiSI CCGG 1 cut(s) 109
Bsp1286I GDGCHC 1 cut(s) 179
Bsp143I GATC 2 cut(s) 24, 133
BspCNI CTCAG 1 cut(s) 61
BspPI GGATC 1 cut(s) 141
BssMI GATC 2 cut(s) 24, 133
BstDEI CTNAG 1 cut(s) 69
BstKTI GATC 2 cut(s) 27, 136
BstMBI GATC 2 cut(s) 24, 133
BstSFI CTRYAG 1 cut(s) 148
CviAII CATG 1 cut(s) 97
CviJI RGCY 2 cut(s) 153, 188
CviKI_1 RGCY 2 cut(s) 153, 188
DdeI CTNAG 1 cut(s) 69
DpnI GATC 2 cut(s) 26, 135
DpnII GATC 2 cut(s) 24, 133
DraIII CACNNNGTG 1 cut(s) 85
FaeI CATG 1 cut(s) 100
FaiI YATR 5 cut(s) 19, 21, 98, 150, 192
FatI CATG 1 cut(s) 96
FbaI TGATCA 1 cut(s) 24
GsuI CTGGAG 1 cut(s) 59
HapII CCGG 1 cut(s) 109
Hin1II CATG 1 cut(s) 100
HpaII CCGG 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 38
HpyF3I CTNAG 1 cut(s) 69
Hsp92II CATG 1 cut(s) 100
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 2 cut(s) 24, 133
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 3 cut(s) 23, 122, 167
MaeIII GTNAC 1 cut(s) 50
MalI GATC 2 cut(s) 26, 135
MboI GATC 2 cut(s) 24, 133
MfeI CAATTG 1 cut(s) 180
MhlI GDGCHC 1 cut(s) 179
MluCI AATT 2 cut(s) 141, 180
MseI TTAA 1 cut(s) 129
MslI CAYNNNNRTG 2 cut(s) 18, 182
MspI CCGG 1 cut(s) 109
MunI CAATTG 1 cut(s) 180
NdeII GATC 2 cut(s) 24, 133
NlaIII CATG 1 cut(s) 100
OliI CACNNNNGTG 1 cut(s) 182
PsiI TTATAA 1 cut(s) 192
RseI CAYNNNNRTG 2 cut(s) 18, 182
SaqAI TTAA 1 cut(s) 129
Sau3AI GATC 2 cut(s) 24, 133
SduI GDGCHC 1 cut(s) 179
SfcI CTRYAG 1 cut(s) 148
SgeI CNNG 7 cut(s) 17, 50, 67, 73, 109, 121, 166
SmiMI CAYNNNNRTG 2 cut(s) 18, 182
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 2 cut(s) 141, 180
TasI AATT 2 cut(s) 141, 180
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.