Rh4DG257100

Protein kinase domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
Physical Location & Seq
Forward (+)
47382973 .. 47383295
323 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG257100.1

Sequence Viewer

Length: 174 bp
ATGGCTGACGATAGTGGTGGCTTGAGTGCTAACAAGGTTGCTGGGCAAGAAGAAGAGAACAGTACGACGCCGTTTCCAGAAAAGGTTTTGATTGCAATAGTTACTTATAGAATGATTTGGGTTACTGAAAGTGATGTTCAATTTATCATAATAAAGCGAAAGAGATTGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

57

Amino Acids

6.38

Weight (kDa)

5.18

Isoelectric Point (pI)

48.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 68
AfaI GTAC 1 cut(s) 64
AgsI TTSAA 1 cut(s) 140
BceAI ACGGC 1 cut(s) 55
BpuEI CTTGAG 1 cut(s) 43
BsaHI GRCGYC 1 cut(s) 68
BseYI CCCAGC 1 cut(s) 41
BssNI GRCGYC 1 cut(s) 68
Bst4CI ACNGT 1 cut(s) 62
Bst6I CTCTTC 1 cut(s) 48
BstACI GRCGYC 1 cut(s) 68
CseI GACGC 1 cut(s) 76
Csp6I GTAC 1 cut(s) 63
CviJI RGCY 2 cut(s) 5, 21
CviKI_1 RGCY 2 cut(s) 5, 21
CviQI GTAC 1 cut(s) 63
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
FaiI YATR 2 cut(s) 108, 149
FspEI CC 9 cut(s) 3, 20, 27, 28, 68, 84, 90, 103, 104
GsaI CCCAGC 1 cut(s) 45
HgaI GACGC 1 cut(s) 76
Hin1I GRCGYC 1 cut(s) 68
Hpy188III TCNNGA 1 cut(s) 77
Hpy99I CGWCG 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 1 cut(s) 95
Hsp92I GRCGYC 1 cut(s) 68
LpnPI CCDG 2 cut(s) 27, 90
MaeIII GTNAC 2 cut(s) 100, 121
MboII GAAGA 2 cut(s) 62, 65
MluCI AATT 1 cut(s) 140
MseI TTAA 1 cut(s) 172
PspFI CCCAGC 1 cut(s) 41
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SaqAI TTAA 1 cut(s) 172
SetI ASST 2 cut(s) 39, 87
SgeI CNNG 5 cut(s) 34, 46, 54, 59, 89
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 1 cut(s) 140
TaaI ACNGT 1 cut(s) 62
TasI AATT 1 cut(s) 140
Tru1I TTAA 1 cut(s) 172
Tru9I TTAA 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.