Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006942.1

Orthogroup ID

OG0002545

Physical Location & Seq

Genomic Coordinates Reverse (-)

4534 .. 7073

Gene Structure 2540 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006942.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

atgacagctttgaacaacttgggtgactccgacgaactagttttgcatgtgatatccataaatctgattgagatttggagcaaaactggagacttgcgaacaaggatagagatagaagaagaaggtaaaagaggctgtaaatataatgatcgagttgttgtggtgaggccgaggacgaggttggctgtgaaaaagctgaaggaggaggaggtgttgccggagccggagaaggagaaggagaaggactgcgtgattgtgatttcggagaaggaagactcggattcggagggtgaaagggaggaagaagaagaagagaacaaagctgtgatggttgacgatagtggtggcttaagtgctaacaaggttgctgggcaagaagaagagaacagtacgacgccgtttccggaaaagcaggattggacgatgacgagtgcagtagcagaacacgagtacgaggacagtagcagaactagacggagtatgagtgtagcgagtgcagtagcaggattagacaatcataagtgcagtagcggaacatga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04011 ko04392 map04011 map04392

Pfam Domains

Protein Families

Pkinase

Protein Analysis

179

Amino Acids

20.04

Weight (kDa)

4.65

Isoelectric Point (pI)

71.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002545)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g02130 FvH4_4g19090 FvH4_4g19090 FvH4_4g19090 FvH4_4g19090
malus_domestica	MD02G1308900.v1.1
rosa_chinensis	RchiOBHm_Chr1g0316701 RchiOBHm_Chr1g0322201 RchiOBHm_Chr1g0331421
rosa_laevigata	RLG00000001007 RLG00000015282 RLG00000018939 RLG00000021189 RLG00000022243 RLG00000026167 RLG00000032388
rosa_multiflora	Rmu_sc0002667.1_g000001 Rmu_sc0005467.1_g000011 Rmu_sc0006942.1_g000001 Rmu_sc0007199.1_g000009 Rmu_sc0011314.1_g000010
rosa_roxburghii	Rroxscaffold_6G00406050 Rroxscaffold_7G00160900
rosa_samantha	Rh1AG023400 Rh1CG020200 Rh1CG022200 Rh1DG017900 Rh1DG020300 Rh1DG020900 Rh2AG275200 Rh2BG437500 Rh3DG271900 Rh4BG003200 Rh4BG137900 Rh4CG142900 Rh4DG257100 Rh5AG116000 Rh6CG275000 Rh7DG386000
rosa_wichuraiana	Rw1G001510 Rw1G001710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccIII	TCCGGA	1 cut(s)	403
AciI	CCGC	1 cut(s)	531
AcuI	CTGAAG	1 cut(s)	218
AcyI	GRCGYC	1 cut(s)	395
AfaI	GTAC	2 cut(s)	391, 452
AflII	CTTAAG	1 cut(s)	349
AgsI	TTSAA	1 cut(s)	13
AhlI	ACTAGT	1 cut(s)	37
AluBI	AGCT	3 cut(s)	8, 196, 323
AluI	AGCT	3 cut(s)	8, 196, 323
Alw26I	GTCTC	1 cut(s)	84
Aor13HI	TCCGGA	1 cut(s)	403
AoxI	GGCC	1 cut(s)	167
AsuHPI	GGTGA	3 cut(s)	35, 175, 302
BauI	CACGAG	1 cut(s)	446
BbsI	GAAGAC	1 cut(s)	279
BccI	CCATC	1 cut(s)	322
BceAI	ACGGC	1 cut(s)	382
BcoDI	GTCTC	1 cut(s)	84
BcuI	ACTAGT	1 cut(s)	37
BfaI	CTAG	2 cut(s)	38, 471
BfrI	CTTAAG	1 cut(s)	349
BmiI	GGNNCC	1 cut(s)	222
BpiI	GAAGAC	1 cut(s)	279
BpmI	CTGGAG	1 cut(s)	108
BsaHI	GRCGYC	1 cut(s)	395
BsaJI	CCNNGG	1 cut(s)	170
BsaWI	WCCGGW	1 cut(s)	403
BsaXI	ACNNNNNCTCC	4 cut(s)	197, 227, 469, 499
Bse1I	ACTGG	1 cut(s)	91
BseAI	TCCGGA	1 cut(s)	403
BseDI	CCNNGG	1 cut(s)	170
BseNI	ACTGG	1 cut(s)	91
BseRI	GAGGAG	2 cut(s)	218, 221
BseYI	CCCAGC	1 cut(s)	368
BsgI	GTGCAG	2 cut(s)	453, 516
BshFI	GGCC	1 cut(s)	169
BsiSI	CCGG	3 cut(s)	218, 224, 404
BsmAI	GTCTC	1 cut(s)	84
BsnI	GGCC	1 cut(s)	169
Bsp13I	TCCGGA	1 cut(s)	403
Bsp143I	GATC	1 cut(s)	148
BspACI	CCGC	1 cut(s)	531
BspANI	GGCC	1 cut(s)	169
BspEI	TCCGGA	1 cut(s)	403
BspLI	GGNNCC	1 cut(s)	222
BspTI	CTTAAG	1 cut(s)	349
BsrI	ACTGG	1 cut(s)	91
BssECI	CCNNGG	1 cut(s)	170
BssMI	GATC	1 cut(s)	148
BssNI	GRCGYC	1 cut(s)	395
BssSI	CACGAG	1 cut(s)	446
Bst2BI	CACGAG	1 cut(s)	446
Bst4CI	ACNGT	2 cut(s)	389, 461
Bst6I	CTCTTC	2 cut(s)	306, 375
BstACI	GRCGYC	1 cut(s)	395
BstAFI	CTTAAG	1 cut(s)	349
BstKTI	GATC	1 cut(s)	151
BstMAI	GTCTC	1 cut(s)	84
BstMBI	GATC	1 cut(s)	148
BstNSI	RCATGY	1 cut(s)	50
BstV2I	GAAGAC	1 cut(s)	279
BsuRI	GGCC	1 cut(s)	169
CseI	GACGC	1 cut(s)	403
Csp6I	GTAC	2 cut(s)	390, 451
CviAII	CATG	2 cut(s)	47, 537
CviJI	RGCY	8 cut(s)	8, 135, 169, 185, 196, 223, 323, 348
CviKI_1	RGCY	8 cut(s)	8, 135, 169, 185, 196, 223, 323, 348
CviQI	GTAC	2 cut(s)	390, 451
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
Eam1104I	CTCTTC	2 cut(s)	306, 375
EarI	CTCTTC	2 cut(s)	306, 375
Eco32I	GATATC	1 cut(s)	54
Eco57I	CTGAAG	1 cut(s)	218
EcoRV	GATATC	1 cut(s)	54
FaeI	CATG	2 cut(s)	50, 540
FaiI	YATR	6 cut(s)	48, 59, 144, 482, 519, 538
FatI	CATG	2 cut(s)	46, 536
FspBI	CTAG	2 cut(s)	38, 471
GsaI	CCCAGC	1 cut(s)	372
GsuI	CTGGAG	1 cut(s)	108
HaeIII	GGCC	1 cut(s)	169
HapII	CCGG	3 cut(s)	218, 224, 404
HgaI	GACGC	1 cut(s)	403
Hin1I	GRCGYC	1 cut(s)	395
Hin1II	CATG	2 cut(s)	50, 540
HincII	GTYRAC	1 cut(s)	334
HindII	GTYRAC	1 cut(s)	334
HinfI	GANTC	3 cut(s)	26, 275, 281
HpaII	CCGG	3 cut(s)	218, 224, 404
HphI	GGTGA	3 cut(s)	35, 175, 302
Hpy166II	GTNNAC	1 cut(s)	334
Hpy188I	TCNGA	5 cut(s)	31, 66, 265, 280, 286
Hpy188III	TCNNGA	1 cut(s)	404
Hpy8I	GTNNAC	1 cut(s)	334
Hpy99I	CGWCG	2 cut(s)	35, 397
HpyAV	CCTTC	6 cut(s)	116, 193, 223, 229, 235, 262
HpyCH4III	ACNGT	2 cut(s)	389, 461
HpyCH4V	TGCA	4 cut(s)	46, 434, 497, 525
Hsp92I	GRCGYC	1 cut(s)	395
Hsp92II	CATG	2 cut(s)	50, 540
Kpn2I	TCCGGA	1 cut(s)	403
Kzo9I	GATC	1 cut(s)	148
LmnI	GCTCC	2 cut(s)	78, 220
LpnPI	CCDG	7 cut(s)	72, 231, 237, 354, 398, 417, 489
MaeI	CTAG	2 cut(s)	38, 471
MaeIII	GTNAC	1 cut(s)	23
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MboII	GAAGA	9 cut(s)	128, 131, 284, 314, 317, 320, 323, 389, 392
MlyI	GAGTC	2 cut(s)	20, 269
MmeI	TCCRAC	1 cut(s)	54
MroI	TCCGGA	1 cut(s)	403
MseI	TTAA	1 cut(s)	350
MspCI	CTTAAG	1 cut(s)	349
MspI	CCGG	3 cut(s)	218, 224, 404
NdeII	GATC	1 cut(s)	148
NlaIII	CATG	2 cut(s)	50, 540
NlaIV	GGNNCC	1 cut(s)	222
NmeAIII	GCCGAG	1 cut(s)	195
NmuCI	GTSAC	1 cut(s)	23
NspI	RCATGY	1 cut(s)	50
PfeI	GAWTC	1 cut(s)	281
PleI	GAGTC	2 cut(s)	20, 269
PpsI	GAGTC	2 cut(s)	20, 269
PspFI	CCCAGC	1 cut(s)	368
PspN4I	GGNNCC	1 cut(s)	222
RsaI	GTAC	2 cut(s)	391, 452
RsaNI	GTAC	2 cut(s)	390, 451
SaqAI	TTAA	1 cut(s)	350
Sau3AI	GATC	1 cut(s)	148
SchI	GAGTC	2 cut(s)	20, 269
SetI	ASST	7 cut(s)	10, 127, 182, 198, 213, 325, 366
SmlI	CTYRAG	1 cut(s)	349
SmoI	CTYRAG	1 cut(s)	349
SpeI	ACTAGT	1 cut(s)	37
SsiI	CCGC	1 cut(s)	531
SspMI	CTAG	2 cut(s)	38, 471
TaaI	ACNGT	2 cut(s)	389, 461
TaqI	TCGA	1 cut(s)	151
TfiI	GAWTC	1 cut(s)	281
Tru1I	TTAA	1 cut(s)	350
Tru9I	TTAA	1 cut(s)	350
TseFI	GTSAC	1 cut(s)	23
Tsp45I	GTSAC	1 cut(s)	23
TspGWI	ACGGA	1 cut(s)	490
Vha464I	CTTAAG	1 cut(s)	349
XceI	RCATGY	1 cut(s)	50
XspI	CTAG	2 cut(s)	38, 471

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.