Rh5AG116000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
10789598 .. 10789953
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG116000.1

Sequence Viewer

Length: 207 bp
ATGGAGGAAGAAGAAGAAGAGAACAAAGCTGTGATGGTTGACGATAGTGGTGGCTTGAGTGCTAACAAGGTTGCTGGGCAAGAAGAAGAGAACAGTACGACACCGTTTCCAGAAAAGGTTTTGATTGCAATAGTTACTTATAGAATGCTTTGGGTTACTGAAAGTGATGCTCAATTTATCATAATAAAGCGAAAGAGATTGTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.7

Weight (kDa)

4.51

Isoelectric Point (pI)

70.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 97
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
BccI CCATC 1 cut(s) 28
BmsI GCATC 1 cut(s) 157
BpuEI CTTGAG 1 cut(s) 76
BseYI CCCAGC 1 cut(s) 74
BsmI GAATGC 1 cut(s) 150
Bst4CI ACNGT 2 cut(s) 95, 105
Bst6I CTCTTC 2 cut(s) 12, 81
Csp6I GTAC 1 cut(s) 96
CviJI RGCY 2 cut(s) 29, 54
CviKI_1 RGCY 2 cut(s) 29, 54
CviQI GTAC 1 cut(s) 96
Eam1104I CTCTTC 2 cut(s) 12, 81
EarI CTCTTC 2 cut(s) 12, 81
FaiI YATR 2 cut(s) 141, 182
GsaI CCCAGC 1 cut(s) 78
HincII GTYRAC 1 cut(s) 40
HindII GTYRAC 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4III ACNGT 2 cut(s) 95, 105
HpyCH4V TGCA 1 cut(s) 128
LpnPI CCDG 2 cut(s) 60, 123
LweI GCATC 1 cut(s) 157
MaeIII GTNAC 2 cut(s) 133, 154
MboII GAAGA 6 cut(s) 20, 23, 26, 29, 95, 98
MluCI AATT 1 cut(s) 173
MseI TTAA 1 cut(s) 205
Mva1269I GAATGC 1 cut(s) 150
PctI GAATGC 1 cut(s) 150
PspFI CCCAGC 1 cut(s) 74
RsaI GTAC 1 cut(s) 97
RsaNI GTAC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 205
SetI ASST 3 cut(s) 31, 72, 120
SfaNI GCATC 1 cut(s) 157
SgeI CNNG 5 cut(s) 67, 79, 87, 92, 122
SmlI CTYRAG 1 cut(s) 55
SmoI CTYRAG 1 cut(s) 55
Sse9I AATT 1 cut(s) 173
TaaI ACNGT 2 cut(s) 95, 105
TasI AATT 1 cut(s) 173
Tru1I TTAA 1 cut(s) 205
Tru9I TTAA 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.