Rh7DG386000

Protein kinase domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
52726609 .. 52741483
14875 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG386000.1

Sequence Viewer

Length: 219 bp
ATGGCTGACGATAGTGGTGGCTTGAGTGCTAACAAGGTTGCTGGGCAAGAAGAAGAGAACAGTACTACGCCGTTTCTAGAAAAGGTCATGATCGTTTCAGATAATACGAAAGCAACAGGGGGGAGGTGTGGTGATAATTGGAACATGGAAGAGGGTATAGATGACAATGAAAAGGAGAAGATAAAGCAATCAGCAATGAGAGAGATTGAACATAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.88

Weight (kDa)

4.43

Isoelectric Point (pI)

45.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 64
AgsI TTSAA 1 cut(s) 209
AsuHPI GGTGA 1 cut(s) 143
BceAI ACGGC 1 cut(s) 55
BfaI CTAG 1 cut(s) 77
BmcAI AGTACT 1 cut(s) 64
BpuEI CTTGAG 1 cut(s) 43
BsaXI ACNNNNNCTCC 2 cut(s) 115, 145
Bse3DI GCAATG 1 cut(s) 201
BseMI GCAATG 1 cut(s) 201
BseYI CCCAGC 1 cut(s) 41
Bsp143I GATC 1 cut(s) 90
BspHI TCATGA 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 201
BssMI GATC 1 cut(s) 90
Bst4CI ACNGT 1 cut(s) 62
Bst6I CTCTTC 2 cut(s) 48, 144
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
CciI TCATGA 1 cut(s) 87
Csp6I GTAC 1 cut(s) 63
CviAII CATG 2 cut(s) 88, 145
CviJI RGCY 2 cut(s) 5, 21
CviKI_1 RGCY 2 cut(s) 5, 21
CviQI GTAC 1 cut(s) 63
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Eam1104I CTCTTC 2 cut(s) 48, 144
EarI CTCTTC 2 cut(s) 48, 144
FaeI CATG 2 cut(s) 91, 148
FaiI YATR 4 cut(s) 89, 146, 158, 213
FatI CATG 2 cut(s) 87, 144
FspBI CTAG 1 cut(s) 77
GsaI CCCAGC 1 cut(s) 45
Hin1II CATG 2 cut(s) 91, 148
HphI GGTGA 1 cut(s) 143
Hpy188I TCNGA 1 cut(s) 100
Hpy188III TCNNGA 2 cut(s) 77, 88
HpyCH4III ACNGT 1 cut(s) 62
Hsp92II CATG 2 cut(s) 91, 148
Kzo9I GATC 1 cut(s) 90
LpnPI CCDG 2 cut(s) 27, 102
MaeI CTAG 1 cut(s) 77
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 4 cut(s) 62, 65, 161, 190
MluCI AATT 1 cut(s) 136
MnlI CCTC 2 cut(s) 117, 145
NdeII GATC 1 cut(s) 90
NlaIII CATG 2 cut(s) 91, 148
PagI TCATGA 1 cut(s) 87
PspFI CCCAGC 1 cut(s) 41
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
Sau3AI GATC 1 cut(s) 90
ScaI AGTACT 1 cut(s) 64
SetI ASST 3 cut(s) 39, 87, 128
SgeI CNNG 8 cut(s) 34, 46, 54, 59, 89, 100, 129, 157
SmlI CTYRAG 1 cut(s) 22
SmoI CTYRAG 1 cut(s) 22
Sse9I AATT 1 cut(s) 136
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 1 cut(s) 62
TasI AATT 1 cut(s) 136
TatI WGTACW 1 cut(s) 62
TspDTI ATGAA 1 cut(s) 183
XbaI TCTAGA 1 cut(s) 76
XspI CTAG 1 cut(s) 77
ZrmI AGTACT 1 cut(s) 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.